معلومة

كيف نشأ التنوع بين تخمير الإيثانول وتخمير حمض اللاكتيك؟


بكل بساطة ، تقوم بعض الكائنات الحية باستقلاب الجلوكوز في ظل الظروف اللاهوائية عبر الجلوكوز -> (2) حمض بيروفيك -> (2) كحول الإيثيل. ومع ذلك ، فإن بعض الكائنات الحية تستقلب إلى حمض اللاكتيك.

متى نشأت مثل هذه العملية (حمض اللاكتيك) كيميائيًا حيويًا من التخمير المرتبط بها (الإيثانول) ، وكيف تم اختيارها؟ أي ما هي المزايا؟

أيضًا ، هل يمكن لشخص ما إنشاء علامة تحلل السكر أو علامة التخمير؟


أولاً ، ليس من الواضح من علم وظائف الأعضاء أو المعلومات البيوكيميائية وحدها تحديد ما الذي تطور من ماذا. البيروفات الوسيطة موجودة دائمًا ، لذلك نازعة هيدروجين اللاكتوز (لد) و بيروفات ديكاربوكسيلاز (PDC) يمكن أن يتطور كل منهما في أي وقت ، وهناك أسباب وجيهة لكليهما:

  1. LDH: تفاعل البيروفات + NADH / H + = اللاكتات + NAD + + 25 kJ / mol شديد الطاقة ، أي ينتج حرارة
  2. PDC: تفاعل البيروفات = أسيتالديهيد + ثاني أكسيد الكربون (ومع وجود ALD) أسيتالديهيد + NADH / H + = إيثانول + NAD + حيث يكون الإيثانول سامًا للأنواع الأخرى

أضف إليها أن هناك كائنات مثل Sch. بومبي التي لديها على حد سواء الإنزيمات ، لذلك يمكن أن تفعل كلا التفاعلين ، يجب أن تكون أسئلتك بالأحرى:

كيف تطور إنزيم LDH؟

يشبه الإنزيم نازعة هيدروجين المالات ، وكلاهما يشكلان عائلة. ينتمون إلى مجموعة من الإنزيمات التي تحتوي جميعها على مجال ربط NAD (P)، لذلك ليس بعيد المنال أن نذكر أن LDH و MDH تطورتا من إنزيم آخر مع مجال ربط NAD (P).

http://www.ebi.ac.uk/interpro/IEntry؟ac=IPR016040

كيف تطور إنزيم PDC؟

تمت مقارنة متواليات بروتين بيروفات ديكاربوكسيلاز (PDC) المشتقة من الخميرة المستنسخة (Saccharomyces cerevisiae) والجينات البكتيرية (Zymomonas mobilis) مع بعضها البعض ومع قواعد بيانات التسلسل. تم العثور على تشابه كبير في التسلسل بينهما ومع اثنين آخرين: أوكسيديز البيروفات المرتبط بالسيتوكروم من Escherichia coli و acetolactate synthase (ilvI in E. coli ؛ جين ILV2 في S. cerevisiae). كل تحفيز نزع الكربوكسيل من البيروفات باستخدام بيروفوسفات الثيامين (TPP) كعامل مساعد. يشير التشابه العام العام إلى أصل مشترك لهذه الإنزيمات.

مقتبس من ملخص

جرين ، جيريمي. "بيروفات ديكاربوكسيلاز مثل سينسيز أسيتولاكتات ( ILV2) وليس مثل وحدة بيروفات ديهيدروجينيز E1." رسائل FEBS 246.1 (1989): 1-5. http://www.ncbi.nlm.nih.gov/pubmed/2651151؟dopt=Abstract


حلول NCERT للفئة 11 علم الأحياء الفصل 14 التنفس في النباتات

هذه الحلول جزء من حلول NCERT لبيولوجيا الفئة 11. هنا قدمنا ​​حلول NCERT للفصل 11 علم الأحياء الفصل 14 التنفس في النباتات.

السؤال رقم 1.
التفريق بين
(أ) التنفس والاحتراق
(ب) تحلل السكر ودورة كريبس
(ج) التنفس الهوائي والتخمير
حل:
(أ) الاختلافات بين التنفس والاحتراق هي كما يلي:

(ب) الاختلافات بين تحلل السكر ودورة كريبس هي كما يلي:

(ج) الاختلافات بين التنفس الهوائي والتخمير هي كما يلي:

السؤال 2.
ما هي ركائز الجهاز التنفسي؟ قم بتسمية الركيزة التنفسية الأكثر شيوعًا.
حل:
تُعرف المركبات التي تتأكسد خلال هذه العملية باسم ركائز الجهاز التنفسي. عادة ، تتأكسد الكربوهيدرات لإطلاق الطاقة ، ولكن يمكن استخدام البروتينات والدهون وحتى الأحماض العضوية كمواد تنفسية في بعض النباتات ، في ظل ظروف معينة.

السؤال 3.
أعط التمثيل التخطيطي لتحلل السكر.
حل:

السؤال 4.
ما هي الخطوات الرئيسية في التنفس الهوائي؟ اين حدث ذلك؟
حل:
في التنفس الهوائي الذي يحدث داخل الميتوكوندريا ، المنتج النهائي لتحلل السكر ، يتم نقل البيروفات من السيتوبلازم إلى الميتوكوندريا.
الأحداث الحاسمة في التنفس الهوائي هي:
الأكسدة الكاملة للبيروفات عن طريق الإزالة التدريجية لجميع ذرات الهيدروجين ، تاركًا ثلاثة جزيئات من ثاني أكسيد الكربون2.
نقل الإلكترونات التي تمت إزالتها كجزء من ذرات الهيدروجين إلى الجزيئي O2 مع التوليف المتزامن لـ ATP.
تحدث العملية الأولى في مصفوفة الميتوكوندريا بينما تقع العملية الثانية على الغشاء الداخلي للميتوكوندريا.
البيروفات ، التي تتكون من هدم الكربوهيدرات الحال للجليك في العصارة الخلوية ، بعد أن تدخل مصفوفة الميتوكوندريا تخضع لنزع الكربوكسيل التأكسدي عن طريق مجموعة معقدة من التفاعلات المحفزة بواسطة بيروفيك ديهيدروجينيز. تتطلب التفاعلات المحفزة بواسطة نازعة هيدروجين البيروفيك مشاركة العديد من الإنزيمات المساعدة ، بما في ذلك NAD + و Coenzyme A.

خلال هذه العملية ، يتم إنتاج جزيئين من NADH من استقلاب جزيئين من حمض البيروفيك (ينتج من جزيء جلوكوز واحد أثناء تحلل السكر).
ثم يدخل acetyl CoA مسارًا دوريًا ، وهو دورة حمض الكربوكسيليك ، والتي يطلق عليها أكثر شيوعًا باسم دورة كريبس.

السؤال 5.
قدم تمثيلًا تخطيطيًا لعرض شامل لدورة كريبس.
حل:

السؤال 6.
اشرح خدمات الاختبارات التربوية.
حل:
يقع نظام ETS أو نظام النقل الإلكتروني في غشاء الميتوكوندريا الداخلي. يساعد في إطلاق واستخدام الطاقة المخزنة في NADH + H + و FADH2 يتأكسد NADH + H + ، الذي يتشكل خلال دورة حمض الجليكوليك وحمض الستريك ، بواسطة نازعة هيدروجين NADH. يتم نقل الإلكترونات المتولدة على هذا النحو إلى يوبيكوينون من خلال FMN. بطريقة مماثلة ، FADH2 المتولد أثناء دورة حامض الستريك يتم نقله إلى يوبيكوينون. يتم استقبال الإلكترونات من يوبيكوينون بواسطة السيتوكروم قبل الميلاد1، ثم يتم نقله إلى السيتوكروم C. يعمل السيتوكروم C كحامل متنقل بين المركب III ومركب السيتوكروم C أوكسيديز الذي يحتوي على السيتوكروم أ و3، جنبًا إلى جنب مع مراكز النحاس.


أثناء نقل الإلكترونات من كل معقد ، تكون العملية مصحوبة بإنتاج ATP من ADP والفوسفات غير العضوي بواسطة إجراء سينسيز ATP. تعتمد كمية الـ ATP المنتجة على الجزيء المؤكسد.

السؤال 7.
يميز بين الآتي:
(أ) التنفس الهوائي والتنفس اللاهوائي.
(ب) تحلل السكر والتخمير.
(ج) تحلل السكر ودورة حامض الستريك.
حل:
الاختلافات بين التنفس الهوائي والتنفس اللاهوائي هي كما يلي:

الاختلافات بين تحلل السكر والتخمير هي كما يلي:

الاختلافات بين تحلل السكر ودورة حامض الستريك هي كما يلي:

السؤال 8.
ما هي الافتراضات التي تم إجراؤها أثناء حساب صافي ربح ATP؟
حل:

  • هناك مسار متسلسل ومنظم يعمل ، مع ركيزة واحدة تشكل التالي ومع تحلل السكر ، ودورة TCA ، ومسار ETS يتبع واحدًا تلو الآخر.
  • يتم نقل NADH المركب في تحلل السكر إلى الميتوكوندريا ويخضع للفسفرة المؤكسدة.
  • لا يتم استخدام أي من الوسطاء في المسار لتجميع أي مركب آخر.
  • يتم تنفس الجلوكوز فقط - ولا تدخل أي ركائز بديلة أخرى إلى المسار في أي من المراحل الوسيطة.

السؤال 9.
ناقش "المسار التنفسي هو مسار برمائي".
حل:
يُفترض عمومًا أن التنفس عملية تقويضية لأنه أثناء التنفس ، يتم تكسير ركائز مختلفة للحصول على الطاقة. تتحلل الكربوهيدرات إلى جلوكوز قبل دخولها في مسارات الجهاز التنفسي. يتم تحويل الدهون إلى أحماض دهنية وجليسيرول بينما يتم تحويل الأحماض الدهنية إلى أسيتيل CoA قبل دخول التنفس. بطريقة مماثلة ، يتم تحويل البروتينات إلى أحماض أمينية ، والتي تدخل التنفس بعد نزع الأمين.

أثناء تخليق الأحماض الدهنية ، يتم سحب أسيتيل CoA من المسار التنفسي. أيضا ، في تركيب البروتينات ، يتم سحب مواد الجهاز التنفسي. وبالتالي ، يشارك التنفس أيضًا في عملية الابتنائية. لذلك ، يمكن أن يسمى التنفس. المسار البرمائي لأنه يتضمن كلا من الابتنائية والتقويض.

السؤال 10.
تحديد RQ. ما هي قيمته بالنسبة للدهون؟
حل:
نسبة حجم ثاني أكسيد الكربون2 تطورت إلى حجم O2 يستهلك في التنفس يسمى حاصل الجهاز التنفسي (RQ) أو نسبة التنفس.

السؤال 11.
ما هو الفسفرة المؤكسدة؟
حل:

على الرغم من أن عملية التنفس الهوائية تحدث فقط في وجود الأكسجين ، فإن دور الأكسجين يقتصر على المرحلة النهائية من العملية. ومع ذلك ، فإن وجود الأكسجين أمر حيوي ، لأنه يقود العملية برمتها عن طريق إزالة الهيدروجين من النظام. يعمل الأكسجين كمستقبل نهائي للهيدروجين. على عكس الفسفرة الضوئية حيث يتم استخدام الطاقة الضوئية لإنتاج التدرج البروتوني المطلوب للفسفرة ، في التنفس ، إنها طاقة تقليل الأكسدة المستخدمة في نفس العملية. ولهذا السبب تسمى العملية الفسفرة المؤكسدة.

السؤال 12.
ما هي أهمية الإطلاق التدريجي للطاقة في التنفس؟
حل:
أثناء الأكسدة داخل الخلية ، لا يتم إطلاق كل الطاقة الموجودة في ركائز الجهاز التنفسي مجانًا في الخلية ، أو في خطوة واحدة. يتم إطلاقه في سلسلة من التفاعلات التدريجية البطيئة التي تتحكم فيها الإنزيمات ، ويتم احتجازه كطاقة كيميائية في شكل ATP.

ومن ثم ، من المهم أن نفهم أن الطاقة المنبعثة من الأكسدة في التنفس لا تستخدم بشكل مباشر ولكنها تستخدم لتخليق ATP ، والذي يتم تكسيره كلما (وفي أي مكان) تحتاج إلى استخدام الطاقة. وبالتالي ، يعمل ATP كعملة طاقة للخلية.

يتم استخدام هذه الطاقة المحتجزة في ATP في العديد من العمليات التي تتطلب طاقة من الكائنات الحية ، ويتم استخدام الهيكل الكربوني الناتج أثناء التنفس كسلائف للتخليق الحيوي للجزيئات الأخرى في الخلية.

أسئلة إجابة قصيرة جدًا

السؤال رقم 1.
ما هو التنفس اللاهوائي؟ (83 أكتوبر)
حل:
التحلل غير الكامل أو الجزئي لجزيئات الوقود إلى مركبات مثل الكحول الإيثيلي وحمض اللبنيك في غياب الأكسجين الجزيئي.

السؤال 2.
اسم المستقبل النهائي للإلكترون في ETC.
حل:
الأكسجين هو متقبل الإلكترون لـ ETC.
السؤال 3.
وظيفة الأكسجين في التنفس الهوائي:
(ط) يعمل كمقبل نهائي للإلكترون.
(2) يقود العملية برمتها عن طريق إزالة الهيدروجين من النظام.
حل:
وظيفة الأكسجين في التنفس الهوائي:
(أنا) إنه بمثابة متقبل الإلكترون النهائي.
(ثانيا) إنه يقود العملية برمتها عن طريق إزالة الهيدروجين من النظام.

السؤال 4.
ما هو التنفس؟ (86 أكتوبر)
حل:
العملية المؤكسدة التي يتم فيها التقاط الطاقة المرتبطة كيميائيًا من جزيئات الوقود العضوي المعقدة مثل الكربوهيدرات والبروتينات والدهون في شكل ATP.

السؤال 5.
أين يعمل نظام نقل الإلكترون في الميتوكوندريا؟
حل:
يحفز Phosphofructokinase تكوين الفركتوز 1 ، 6 بيسفوسفات من الفركتوز 6-فوسفات.

السؤال 6.
أعط وظيفة فسفوفركتوكيناز في تحلل السكر.
حل:
هيكسوكيناز - يساعد في فسفرة الجلوكوز.

السؤال 7.
قم بتسمية الإنزيم الذي يحفز فسفرة الجلوكوز.
حل:
يحدث تكوين الأسيتيل CoA في مصفوفة الميتوكوندريا.

السؤال 8.
أين يتم تكوين الأسيتيل CoA في الخلية؟
حل:
الخطوة الأولى في دورة كريبس هي تكثيف مجموعة الأسيتيل (أسيتيل CoA) بحمض أوكسالوسيتيك (OAA) لتكوين حمض الستريك وإطلاق الإنزيم المساعد أ.

السؤال 9.
ما هي الخطوة الأولى لرد الفعل في دورة TCA؟
حل:
يمكن تحويل الأحماض الدهنية إلى أسيتيل CoA قبل أن يتم تحويلها من ركائز الجهاز التنفسي.

السؤال 10.
ما هو التخمير الكحولي؟
حل:
التخمير الكحولي هو العملية التي تقوم بها خلايا الخميرة بتكسير الجلوكوز إلى كحول إيثيلي وثاني أكسيد الكربون في ظل ظروف لاهوائية.

السؤال 11.
قم بتسمية المسار التأكسدي الذي يتم من خلاله أكسدة المستقلبات الوسيطة للجلوكوز والأحماض الدهنية والأحماض الأمينية.
حل:
يتم الحصول على 36 جزيء ATP / 38 من جزيئات ATP أثناء عملية التنفس وهي مرتبطة بنوع التنفس الهوائي.

السؤال 12.
ما هو تخمير حمض اللاكتيك؟ (أكتوبر 2001)
حل:
إنها عملية التخمير التي يتم من خلالها تحويل اللاكتوز الموجود في الحليب إلى حمض اللاكتيك عن طريق عمل العصيات اللبنية.

السؤال 13.
ما هما الجزيئان اللذان تم الحصول عليهما بفعل الألدولاز من الفركتوز -1 ، -6- ثنائي الفوسفات؟
حل:
يتم إنتاج ATP.

أسئلة إجابة قصيرة

السؤال رقم 1.
كيف يتم إنشاء التدرج البروتوني؟
حل:
يتم إنشاء التدرج البروتوني عن طريق تمرير البروتون (H +) من المصفوفة عبر الغشاء الداخلي للميتوكوندريا إلى الفضاء بين الغشاء مع إطلاق الطاقة أثناء عمليات نقل الإلكترون في ETC.

السؤال 2.
صف خطوات تكوين حمض اللاكتيك من حمض البيروفيك.
حل:
يتم تحفيز حمض البيروفيك بواسطة إنزيم نازعة هيدروجين اللاكتيك. يتم استخدام NADH المتكون في تحلل السكر من أجل الاختزال.

السؤال 3.
كيف تتشكل ATP من الطاقة المنبعثة أثناء نظام نقل الإلكترون في الميتوكوندريا؟
حل:
تتطلب تكوينات ATP إنزيمًا يسمى سينسيز ATP. يتكون من مكونين F0& # 8211 ف1. يصبح ATP- synthase نشطًا في تكوين ATP عند تركيز H + على F.ا الجانب أعلى من F.1 الجانب. يتسبب تركيز البروتون المتطاير في الغرفة الخارجية في مرور البروتون للغرفة الداخلية. F1 الجسيم الناجم عن تدفق البروتون عبر Fا قناة. تربط طاقة التدرج البروتوني جذر الفوسفات بـ ADP. ينتج هذا ATP.

السؤال 4.
قدم حسابًا تفصيليًا للمكاسب الصافية لـ ATP في مراحل مختلفة من التنفس.
حل:

في معظم الخلايا حقيقية النواة ، يلزم وجود جزيئين من ATP لنقل NADH المنتج في تحلل السكر إلى الميتوكوندريا لمزيد من الأكسدة. ومن ثم فإن صافي ربح ATP هو 36 جزيء.

السؤال 5.
تعداد وظائف ATP.
حل:
وظائف ATP: -
(أنا) يعمل ATP كحامل طاقة عالمي للأنظمة الحية.
(ثانيا) يخزن ATP حزمًا صغيرة من الطاقة في جزيئاته.
(ثالثا) إنه متحرك في الخلية. لذلك ، يصل إلى جميع أجزاء الخلية بعيدًا عن منطقة تخليق ATP.
(رابعا) ينشط عددًا من المواد الكيميائية من خلال العمل كعامل فسفرة.
(الخامس) يوفر ATP الطاقة لتقلص العضلات.
(السادس) يشارك في نقل المواد مقابل تدرج التركيز.

السؤال 6.
أين يقع السيتوكروم ج؟ ما هي وظيفتها؟
حل:
يقع السيتوكروم ج على السطح الخارجي للغشاء الداخلي للميتوكوندريا. يعمل كحامل متنقل لنقل الإلكترونات بين المركب III و IV المعقد لنظام نقل الإلكترون.

السؤال 7.
تحديد حاصل الجهاز التنفسي.
حل:
يتم تعريف حاصل الجهاز التنفسي على أنه نسبة حجم ثاني أكسيد الكربون المتطور إلى حجم الأكسجين المستهلك في التنفس.

السؤال 8.
ما هو الفسفرة المؤكسدة؟
حل:
تسمى العملية الكاملة التي يسمح بها الأكسجين بشكل فعال بإنتاج ATP عن طريق الفسفرة لـ ADP الفسفرة المؤكسدة.

السؤال 9.
مردود الطاقة من حيث ATP أعلى في التنفس الهوائي منه أثناء التنفس اللاهوائي. لماذا يوجد التنفس اللاهوائي حتى في الكائنات الحية التي تعيش في ظروف هوائية مثل البشر و كاسيات البذور؟
حل:
الكائنات الهوائية تواجه مواقف يكون فيها توافر الأكسجين قليلًا. على سبيل المثال ، لا تتلقى العضلات المرهقة ما يكفي من الأكسجين أثناء التمرينات الشاقة. وبالمثل ، فإن أنسجة كاسيات البذور العميقة الجذور لا تتلقى ما يكفي من الأكسجين من خلال الانتشار من الخارج. في مثل هذه الحالات ، فقط التنفس اللاهوائي يمكن أن يساعد في بقاء الأنسجة.

السؤال 10.
علق على العبارة - "التنفس عملية منتجة للطاقة ولكن ATP يستخدم في بعض خطوات العملية".
حل:
مطلوب ATP في جميع تلك التفاعلات التي تتطلب التنشيط الفسفوري للركيزة. لذلك ، على الرغم من إنتاج الطاقة (مثل ATP) ، يتطلب التنفس ATP في خطوات معينة ، على سبيل المثال الجلوكوز # 8211 الجلوكوز 6-الفوسفات ، الفركتوز 6 الفوسفات - الفركتوز 1 ، 6- ثنائي الفوسفات.

أسئلة إجابة طويلة

السؤال رقم 1.
اشرح الخطوات الرئيسية في دورة كريبس. لماذا تسمى هذه الدورة أيضًا بدورة حامض الستريك؟
حل:
دورة كريبس: تحدث هذه العملية في مصفوفة الميتوكوندريا.
الخطوات الرئيسية لدورة كريبس هي كما يلي:

  • يدخل Acetyl Co-A ، المكون من نزع الكربوكسيل المؤكسد لحمض البيروفيك ، دورة كريبس.
  • يتحد مع حمض الخليك أوكسالو (OAA) ، مركب 4C ، لتكوين مركب 6C ، حامض الستريك ، يتم تحفيز التفاعل بواسطة سينسيز السترات.
  • ثم يتحول السيترات إلى أيزوسترات.
  • يتم تحويل Isocitrate إلى حمض أوكسالوسكسينيك في وجود NAD و isocitrate dehydrogenase.
  • يتم بعد ذلك نزع الكربوكسيل من حمض الأوكسالوسكسينيك إلى حمض أ-كيتوجلوتاريك (KG) ، في وجود إنزيم ديكاربوكسيلاز.
  • يتم تحويل حمض a-ketoglutaric إلى succinyl Co-A في وجود NAD و Co- A وإنزيم a-ketoglutarate dehydrogenase.
  • عندما يتم تحويل succinyl Co-A إلى حمض السكسينيك ، يتم تكوين جزيء واحد من GTP ويتم إطلاق Co-A.
  • في الجزء المتبقي من الدورة ، يتم تحويل حمض السكسينيك إلى OAA ، بحيث تستمر دورة حمض الستريك في العمل.
  • خلال هذه الدورة ، يتم تقليل ثلاثة جزيئات من NAD وجزيء واحد من FAD إلى NADH و FADH على التوالي.
  • تسمى هذه الدورة بدورة حامض الستريك لأن المنتج الأول هو حامض الستريك وهو مركب 3-C.

السؤال 2.
اسم المنتج النهائي لتحلل السكر. أين يتم إنتاجه في الخلية؟ ناقش عملية نزع الكربوكسيل المؤكسدة.
حل:
ينتج عن تحلل السكر تكوين جزيئين من حمض البيروفيك ، NADH ، و ATP. يحدث في العصارة الخلوية للخلية.
الأكسدة الهوائية: يتأكسد أحد الكربونات الثلاثة لحمض البيروفيك إلى ثاني أكسيد الكربون في تفاعل يسمى نزع الكربوكسيل المؤكسد. يتم أولاً نزع الكربوكسيل من حمض البيروفيك ثم يتأكسد بواسطة إنزيم البيروفيك ديهيدروجينيز. يتم قبول الوحدات ثنائية الكربون بسهولة بواسطة الإنزيم A (Co-A) لتكوين acetyl Co-A. يرد ملخص التفاعل في المعادلة التالية:

وهكذا ، يدخل حمض البيروفيك دورة كريبس كأسيتيل Co-A. تحدث دورة كريبس في مصفوفة الميتوكوندريا.
يدخل Acetyl Co-A ، المكون من نزع الكربوكسيل المؤكسد لحمض البيروفيك ، دورة كريبس.

السؤال 3.
تمثل بشكل تخطيطي العلاقة المتبادلة بين مسارات التمثيل الغذائي في النبات ، مما يدل على التنفس بوساطة انهيار المركبات العضوية المختلفة.
حل:
تمثيل تخطيطي بين المسارات الأيضية يظهر انهيار التنفس بوساطة جزيئات عضوية مختلفة لثاني أكسيد الكربون2 و ح2س:

السؤال 4.
كيف تدير المصانع تبادل الغازات؟ أعط لمحة عامة عن التنفس في النباتات.
حل:
النباتات ، على عكس الحيوانات ، ليس لها أعضاء متخصصة للتبادل الغازي ولكن لديها ثغور وعدسات لهذا الغرض. هناك العديد من الأسباب التي تجعل النباتات تتماشى بدون أعضاء الجهاز التنفسي.

  • يعتني كل جزء من أجزاء المصنع باحتياجات تبادل الغازات الخاصة به. هناك القليل جدًا من نقل الغازات من جزء مصنع إلى آخر.
  • لا تقدم النباتات طلبات كبيرة لتبادل الغازات. تنبع الجذور وتترك التنفس بمعدل أقل من الحيوانات.
  • فقط أثناء عملية التمثيل الضوئي ، يتم تبادل كميات كبيرة من عقود الإيجار ، ويتم تكييف كل ورقة بشكل جيد لتلبية احتياجاتها الخاصة خلال هذه الفترات.
  • عندما تقوم الخلايا بعملية التمثيل الضوئي ، فإن توافر O2 ليست مشكلة في هذه الخلايا منذ 02 اطلق سراحه
  • المسافة التي يجب أن تنتشرها الغازات حتى في النباتات الضخمة الضخمة ليست كبيرة. تقع كل خلية حية في النبات بالقرب من سطح النبات.
  • حتى في السيقان الخشبية ، يتم تنظيم الخلايا "الحية" في طبقات رقيقة داخل وتحت اللحاء. لديهم أيضًا فتحات تسمى العدسات. الخلايا في الداخل ميتة ولا توفر سوى الدعم الميكانيكي.
  • وبالتالي ، فإن معظم خلايا النبات تشهد على تلامس جزء من سطحها مع الهواء. يتم تسهيل ذلك أيضًا من خلال التعبئة الفضفاضة لخلايا الحمة في الأوراق والسيقان والجذور ، والتي توفر شبكة مترابطة من المساحات الهوائية.
  • الاحتراق الكامل للجلوكوز الذي ينتج ثاني أكسيد الكربون2 و ح20 كمنتجات نهائية ، ينتج طاقة. يتم إعطاء معظم الطاقة على شكل حرارة.
    ج6ح12ا6 + 6O2 → 6C02 + 6 ح20 + طاقة
  • إذا كانت هذه الطاقة مفيدة للخلية ، فيجب أن تكون قادرة على استخدامها لتخليق الجزيئات الأخرى التي تتطلبها الخلية.
  • تتمثل الإستراتيجية التي تستخدمها الخلية النباتية في تقويض جزيء الجلوكوز بطريقة لا تخرج فيها كل الطاقة المحررة كحرارة.
  • المفتاح هو أكسدة الجلوكوز ليس بخطوة واحدة ولكن في عدة خطوات صغيرة تمكن بعض الخطوات من أن تكون كبيرة بما يكفي بحيث يمكن اقتران الطاقة المنبعثة بتخليق ATP.

نأمل أن تساعدك حلول NCERT لبيولوجيا الفئة 11 في العمل ، الفصل 14 ، التنفس في النباتات. إذا كان لديك أي استفسار بخصوص NCERT Solutions for Class 11 Biology at Work Chapter 14 Respiration in Plants ، فقم بإسقاط تعليق أدناه وسنعاود الاتصال بك في أقرب وقت ممكن.


كيف نشأ التنوع بين تخمير الإيثانول وتخمير حمض اللاكتيك؟ - مادة الاحياء

تنوع التمثيل الغذائي في النوى البدائية (الصفحة 1)

هناك الكثير من الهرج والمرج حول التنوع الميكروبي. تُظهر حقيقيات النوى أحادية الخلية (البروتيستا) قدرًا معقولاً من التنوع البنيوي ، لكن بدائيات النوى (البكتيريا والعتائق) تفتقر إلى هذا التمييز. لا يوجد سوى عدد قليل من الأشكال الأساسية ، وإمكانيات الخلايا الحركية والراحة (الجراثيم) ، وصمة عار تفاضلية رئيسية (صبغة جرام) التي تميز البدائيات ميكروسكوبياً. إذن ما هو كل هرجاء بخصوص بدائيات النوى؟ فهو يقع في حوالي البيوكيميائية أو التنوع الأيضي، خاصة فيما يتعلق بعملية التمثيل الغذائي المولدة للطاقة والتخليق الحيوي للمستقلبات الثانوية. تقوم الكائنات البدائية ، كمجموعة ، بإجراء جميع أنواع التمثيل الغذائي الأساسية مثل حقيقيات النوى ، ولكن بالإضافة إلى ذلك ، هناك عدة أنواع من التمثيل الغذائي لتوليد الطاقة بين بدائيات النوى غير الموجودة في الخلايا أو الكائنات حقيقية النواة. يتم التعبير عن تنوع الكائنات البدائية من خلال تنوعها الكبير في أنماط توليد الطاقة والتمثيل الغذائي ، وهذه الميزة تسمح للبدائيات بالازدهار في جميع الموائل المناسبة للحياة على الأرض.

حتى داخل الأنواع بدائية الخلية ، قد يكون هناك تنوع كبير في التمثيل الغذائي. انصح الإشريكية القولونية. يمكن أن تنتج البكتيريا طاقة للنمو عن طريق التخمير أو التنفس. يمكن أن تتنفس هوائيا باستخدام O2 كمستقبل نهائي للإلكترون ، أو يمكنه التنفس تحت ظروف لاهوائية ، باستخدام NO3 أو فومارات كمتقبل طرفي للإلكترون. بكتريا قولونية يمكن استخدام الجلوكوز أو اللاكتوز كمصدر وحيد للكربون للنمو ، مع القدرة الأيضية على تحويل السكر إلى جميع الأحماض الأمينية الضرورية والفيتامينات والنيوكليوتيدات التي تتكون منها الخلايا. أحد أقارب بكتريا قولونية, رودوسبيريلوم روبوم ، لديه كل القدرات غيرية التغذية مثل بكتريا قولونية، بالإضافة إلى القدرة على النمو بوسائل التغذية الضوئية أو التغذية الضوئية أو الصخرية. يتطلب عامل نمو واحدًا ، ولكن يجب إضافة البيوتين إلى وسائط النمو الخاصة به.

بشكل أساسي ، تنتج معظم حقيقيات النوى الطاقة (ATP) من خلال تخمير الكحول (مثل الخميرة) ، تخمر حمض اللاكتيك (مثل خلايا العضلات ، العدلات) ، التنفس الهوائي (مثل القوالب ، البروتوزوا ، الحيوانات) أو التمثيل الضوئي الأكسجين (مثل الطحالب والنباتات). توجد هذه الأنماط من التمثيل الغذائي لتوليد الطاقة بين بدائيات النوى ، بالإضافة إلى جميع الأنواع التالية من إنتاج الطاقة التي تكاد تكون غير موجودة في حقيقيات النوى.

تخمير فريد المضي قدما في مسار Embden-Meyerhof

مسارات التخمير الأخرى مثل فسفوكيتولاز (مغاير) ومسارات إنتنر-دودوروف

التنفس اللاهوائي: التنفس الذي يستخدم فيه مواد أخرى غير O2 كمتقبل نهائي للإلكترون

حصوة التغذية: استخدام المواد غير العضوية كمصادر للطاقة

التغذية الضوئية: استخدام المركبات العضوية كمصدر للكربون أثناء عملية التمثيل الضوئي البكتيري

التمثيل الضوئي غير المؤكسد: الفسفرة الضوئية في غياب O2

تكوين الميثان: نوع قديم من التمثيل الغذائي القديم الذي يستخدم H2 كمصدر للطاقة وينتج غاز الميثان

الفسفرة الضوئية غير الاصطناعية التي يقودها الضوء: التمثيل الغذائي الفريد من نوعه الذي يحول الطاقة الضوئية إلى طاقة كيميائية

بالإضافة إلى ذلك ، من بين بدائيات التغذية الذاتية ، هناك ثلاث طرق لإصلاح ثاني أكسيد الكربون2، اثنان منها غير معروفين بين حقيقيات النوى ، و CODH (مسار أسيتيل CoA) و ال دورة TCA العكسي.

الأيض المولّد للطاقة المصطلح الأيض يشير إلى مجموع التفاعلات الكيميائية الحيوية المطلوبة لتوليد الطاقة واستخدام الطاقة لتجميع مادة الخلية من جزيئات صغيرة في البيئة. ومن ثم ، فإن التمثيل الغذائي له مكون توليد الطاقة، مسمى الهدم، و مستهلك للطاقة, مكون حيوي، مسمى بناء. تنتج التفاعلات أو التسلسلات التقويضية الطاقة مثل ATP، والتي يمكن استخدامها في التفاعلات الابتنائية لبناء مادة الخلية من العناصر الغذائية في البيئة. العلاقة بين الهدم و الابتنائية موضحة في الشكل 1 أدناه.
الشكل 1. العلاقة بين الهدم والتمثيل الغذائي في الخلية. أثناء عملية الهدم ، تتغير الطاقة من شكل إلى آخر ، وتماشياً مع قوانين الديناميكا الحرارية ، فإن تحولات الطاقة هذه لا تكون فعالة بشكل كامل ، أي يتم فقد بعض الطاقة في شكل حرارة. كفاءة تسلسل تقويضي للتفاعلات هي كمية الطاقة المتاحة للخلية (من أجل الابتنائية) مقسومة على الكمية الإجمالية للطاقة المنبعثة أثناء التفاعلات.

أثناء التقويض ، يتم حفظ الطاقة المفيدة مؤقتًا في "رابطة الطاقة العالية" ATP - ثلاثي فوسفات الأدينوزين. بغض النظر عن شكل الطاقة الذي تستخدمه الخلية كمصدر أساسي لها ، يتم تحويل الطاقة في النهاية والحفاظ عليها باعتبارها ATP - العملة العالمية لتبادل الطاقة في الأنظمة البيولوجية. عندما تكون الطاقة مطلوبة أثناء عملية التمثيل الغذائي ، فقد يتم إنفاقها على أنها رابطة عالية الطاقة لـ ATP والتي تبلغ قيمتها حوالي 8 كيلو كالوري لكل مول. وبالتالي ، يتطلب تحويل ADP إلى ATP 8 كيلو كالوري من الطاقة ، ويطلق التحلل المائي لـ ATP إلى ADP 8 كيلو كالوري.


الشكل 2. هيكل ATP. يُشتق ATP من النيوكليوتيدات أحادي فوسفات الأدينوسين (AMP) أو حمض الأدينيل ، حيث يتم ربط مجموعتين إضافيتين من الفوسفات من خلال روابط البيروفوسفات (

ص). هذان الرابطان غنيان بالطاقة بمعنى أن تحللهما المائي ينتج طاقة أكبر بكثير من الرابطة التساهمية المقابلة. يعمل ATP كنزيم مساعد في تفاعلات الاقتران النشط حيث تتم إزالة إحدى مجموعات الفوسفات الطرفية أو كليهما من جزيء ATP مع استخدام طاقة الرابطة لنقل جزء من ATP إلى جزيء آخر لتنشيط دوره في عملية التمثيل الغذائي. على سبيل المثال ، الجلوكوز + ATP ----- & GT الجلوكوز- P + ADP أو الأحماض الأمينية + ATP ----- & GTحمض أميني أميني + PPi.

بسبب الدور المركزي لـ ATP في التمثيل الغذائي لتوليد الطاقة ، توقع أن ترى مشاركته كنزيم في معظم عمليات إنتاج الطاقة في الخلايا.


التحميل الان!

لقد سهلنا عليك العثور على كتب إلكترونية بتنسيق PDF دون أي حفر. ومن خلال الوصول إلى كتبنا الإلكترونية عبر الإنترنت أو عن طريق تخزينها على جهاز الكمبيوتر الخاص بك ، يكون لديك إجابات مناسبة مع دليل دراسة علم الأحياء التخمير وتنفس الخلية. للبدء في العثور على التخمير وتنفس الخلية في دليل دراسة الأحياء ، فأنت محق في العثور على موقعنا الإلكتروني الذي يحتوي على مجموعة شاملة من الأدلة المدرجة.
مكتبتنا هي الأكبر من بين هذه المكتبات التي تحتوي على مئات الآلاف من المنتجات المختلفة الممثلة.

أخيرًا ، حصلت على هذا الكتاب الإلكتروني ، شكرًا على كل هذه التخمر في دليل دراسة الأحياء وتنفس الخلايا التي يمكنني الحصول عليها الآن!

لم أكن أعتقد أن هذا سيعمل ، أظهر لي أفضل أصدقائي هذا الموقع ، وهو يعمل! أحصل على الكتاب الإلكتروني المطلوب

wtf هذا الكتاب الاليكترونى الرائع مجانا ؟!

أصدقائي غاضبون جدًا لدرجة أنهم لا يعرفون كيف أمتلك كل الكتب الإلكترونية عالية الجودة التي لا يعرفون عنها!

من السهل جدًا الحصول على كتب إلكترونية عالية الجودة)

الكثير من المواقع المزيفة. هذا هو أول واحد نجح! تشكرات

wtffff أنا لا أفهم هذا!

ما عليك سوى اختيار النقر ثم زر التنزيل ، وإكمال العرض لبدء تنزيل الكتاب الإلكتروني. إذا كان هناك استبيان يستغرق 5 دقائق فقط ، فجرب أي استطلاع يناسبك.


2. المواد والأساليب

2.1 شروط الكائن الحي والتخمير

كانت LAB المستخدمة في هذه الدراسة L. اللاكتيس subsp. كريموريس MG1363 ، L. اللاكتيس subsp. اللاكتيس IL1403 ، S. ثيرموفيلوس LMG 18311 و L. mesenteroides subsp. كريموريس ATCC 19254. تم استخدام الوسط المحدد كيميائيًا (CDM) الموصوف بواسطة (Otto et al. ، 1983) والذي تم تعديله بواسطة (Poolman & Konings ، 1988) لتحضير اللقاح وللتخمير (للحصول على قائمة المكونات الكاملة ، انظر الدعم تم تعقيم ملف المعلومات 1 ، الجدول S1) ، وآلية التنمية النظيفة باستخدام مرشحات 0.22 ميكرومتر. أجريت تجارب التخمير في ظل ظروف لاهوائية في مفاعل حيوي بخزان مقلب سعة 1 لتر (Biostat Q ، B. Braun Biotech International) بحجم عمل قدره 0.6 لتر عند درجة حرارة ثابتة وبدون التحكم في درجة الحموضة (الأس الهيدروجيني الأولي 6.8). النوعين المشتركين في الثقافة L. اللاكتيس subsp. كريموريس و ليو. ميسينتيرويدس، وثلاثة أنواع من الثقافة المشتركة L. اللاكتيس subsp. كريموريس, L. اللاكتيس subsp. اللاكتيس و ليو. ميسينتيرويدس يُفترض أنها تمثل مزارع الجبن المتوسطة ، في حين أن النوعين المشتركين في الثقافة L. اللاكتيس subsp. كريموريس و S. ثيرموفيلوس، وثلاثة أنواع من الثقافة المشتركة L. اللاكتيس subsp. كريموريس, L. اللاكتيس subsp. اللاكتيس و S. ثيرموفيلوس من المفترض أنها تمثل مزارع الجبن المحبة للحرارة. ثقافات نقية L. lactis ، Leu. ميسينتيرويدس، و S. ثيرموفيلوس تم تخمير السلالات عند 30 درجة مئوية ، و 30 درجة مئوية ، و 37 درجة مئوية ، على التوالي ، في حين نمت الثقافات المشتركة المحبة للحرارة والحرارة عند 30 درجة مئوية و 33 درجة مئوية ، على التوالي. تم شطف وسط التخمير باستخدام N المعقم بالفلتر2 حتى انخفض الأكسجين المذاب إلى الصفر قبل التلقيح ، ولم يكن هناك إمداد بالغاز بعد التلقيح. تم افتراض الحفاظ على الظروف اللاهوائية مع الخلط البطيء (50 دورة في الدقيقة). لكل من الثقافات النقية والمشتركة ، تم تلقيح المفاعل الحيوي بثقافة لقاح بنسبة 2 ٪ (حجم / حجم) نمت حتى المرحلة الأسية المتأخرة. كانت تركيبات الكتلة الحيوية الأولية للثقافات المشتركة ، بناءً على قياسات الكثافة البصرية (OD) ، 1: 1 (OD: OD) و 1: 1: 1 (OD: OD: OD) لنوعين وثلاثة أنواع من الثقافات المشتركة على التوالي . لكل تجربة دفعية مختلفة (ثقافات نقية ومشتركة) ، تم تشغيل مكررين مستقلين للثقافة.

2.2 التقنيات التحليلية

تم تحديد تركيز الكتلة الحيوية باستخدام قياسات OD لثقافة التخمير عند 600 نانومتر ، والتي تم ربطها بعد ذلك بالوزن الجاف للكتلة الحيوية (gDW). تم طرد عينات الثقافة بالطرد المركزي عند 10000ز لمدة 10 دقائق ، تم استخدام مادة طافية خالية من الخلايا لتحليل الجلوكوز والأحماض العضوية والأحماض الأمينية. تم تخزين عينات الكتلة الحيوية للثقافات المشتركة على الفور عند درجة حرارة -20 درجة مئوية حتى تحليل الوفرة الميكروبية النسبية. تم تحديد تركيز الجلوكوز عن طريق تقليل تحليل السكر باستخدام طريقة DNS (Miller ، 1959). تم تحديد تركيزات الأحماض العضوية والأحماض الأمينية بواسطة كروماتوجرافيا سائلة عالية الأداء كما هو موضح سابقًا (Özcan et al. ، 2019). كو2 ملامح إنتاج L. اللاكتيس و S. ثيرموفيلوس يُفترض أن السلالات التي تظهر أنماط التخمير المتماثل صغيرة بشكل مهم مقارنةً بالتدفق الكلي للكربون في ظل الظروف اللاهوائية كما هو مذكور أيضًا في الأدبيات (جنسن وآخرون ، 2001). التركيز المولي للإيثانول وثاني أكسيد الكربون2 من إنتاج ليو. ميسينتيرويدس تم تقديرها بناءً على معدلات استهلاك الجلوكوز والسترات كما هو موضح في دراستنا السابقة (Özcan et al. ، 2019).

2.3 تقدير الوفرة الميكروبية النسبية في الثقافات المشتركة

تم استخدام طريقة PCR الكمية (qPCR) لقياس نسب الوفرة الميكروبية النسبية للسلالات البكتيرية المختلفة أثناء الزراعة المشتركة. تضاعف إجمالي تركيزات الوزن الجاف للخلايا في الثقافات المشتركة بنسب الوفرة الميكروبية النسبية لتقدير تركيزات الكتلة الحيوية الفردية. تم استخراج الحمض النووي باستخدام مجموعة peqGOLD Bacterial DNA Kit (Peqlab ، VWR) ، وفقًا لبروتوكول الشركة المصنعة ، من 3 مل من الثقافة. البادئات المستخدمة لإجراء qPCR (الجدول 1) مخصصة لاستهداف الجينوم و iTaq Universal SYBR Green Supermix (Bio-Rad). تم استخدام بروتوكول PCR التالي لجميع العينات: التمسخ الأولي عند 95 درجة مئوية لمدة 5 دقائق ، و 40 دورة من 95 درجة مئوية لمدة 15 ثانية ، و 62 درجة مئوية لمدة 30 ثانية وتحليل منحنى الانصهار بزيادات 0.5 درجة مئوية / 5 ثوانٍ من 65 درجة مئوية إلى 95 درجة مئوية باستخدام CFX96 Touch Real-Time PCR Detection System (Bio-Rad).

تسلسل التمهيدي إلى الأمام تسلسل عكس التمهيدي حجم المنتج PCR مراجع
L. اللاكتيس subsp. كريموريس MG1363 جتجكتجكاككاتتجا GGGATCATCTTTGAGTGAT 163 بو وآخرون. (2002)
L. lactis subsp. اكتيس IL1403 جتاكتجتاككجاكتجات GGGATCATCTTTGAGTGAT 163 بو وآخرون. (2002)
S. ثيرموفيلوس إل إم جي 18311 كججتجاجتااكجكجتاجت كجككتاجتجاجككاتاك 177 هذه الدراسة
ليو. ميسينتيرويدس ATCC 19254 CCGCATCTTCACGGGTATTT اجتكجكجااجتاكجا 173 هذه الدراسة

2.4 نماذج التمثيل الغذائي على نطاق الجينوم (GSMMs) المستخدمة في هذه الدراسة

نموذج التمثيل الغذائي على نطاق الجينوم (GSMM) ليو. ميسينتيرويدس ATCC 19254 (أوزكان وآخرون ، 2019) ، L. اللاكتيس subsp. كريموريس MG1363 (Flahaut وآخرون ، 2013) والنسخة المنقحة من S. ثيرموفيلوس تم استخدام LMG 18311 (Pastink وآخرون ، 2009) ، والتي كانت نفس السلالات المستخدمة في التجارب ، في هذه الدراسة. GSMM L. اللاكتيس subsp. كريموريس تم استخدام MG1363 (Flahaut et al. ، 2013) لمحاكاة البيانات التجريبية لكليهما L. اللاكتيس subsp. كريموريس و L. اللاكتيس subsp. اللاكتيس. بالإضافة إلى استخدام المعلمات الخاصة بالسلالة ، ضمور الأحماض الأمينية L. اللاكتيس subsp. اللاكتيس تم اعتباره أيضًا لمحاكاة هذه السلالة. تم تقييد تفاعلات تبادل الأرجينين والجلوتامين والهيستيدين والأيزولوسين والليوسين والميثيونين والفالين بطريقة لا يمكن للنموذج إلا أن يستهلك هذه الأحماض الأمينية لمحاكاة L. اللاكتيس subsp. اللاكتيس، لأن L. اللاكتيس subsp. اللاكتيس من المعروف أن IL1403 غير قادر على تصنيع هذه الأحماض الأمينية (Aller et al.، 2014 Cocaign-Bousquet et al.، 1995 van Niel & Hahn-Hägerdal، 1999). GSMM الخاص بـ S. ثيرموفيلوس تمت مراجعة LMG 18311 (Pastink et al. ، 2009) عبر الخطوات التالية: (1) مسودة GSMM لـ S. ثيرموفيلوس أعيد بناء LMG 18311 باستخدام تسلسل الجينوم S. thermsophilus LMG 18311 (Bolotin et al.، 2004 GenBank رقم الانضمام GCA_000011825.1) بواسطة MetaDraft (BG Olivier 2018. [Online]، https://systemsbioinformatics.github.io/metadraft) (2) تمت مقارنة مجموعة التفاعل الجديدة مع ذلك من النموذج الأصلي وردود الفعل المتوفرة فقط في مسودة النموذج الجديد تمت إضافتها إلى النموذج الأصلي للحصول على GSMM المنقح S. ثيرموفيلوس LMG 18311. GSMM المنقحة S. ثيرموفيلوس يتوفر LMG 18311 الذي يحتوي على 829 تفاعلًا بين 886 مستقلبًا تحكمها 429 جينًا بتنسيق SBML في Supporting Information File-3. تم الحصول على معدلات صيانة ATP المرتبطة بعدم النمو والمستخدمة في GSMMs من دراسات النماذج الأصلية (Flahaut et al. ، 2013 Oliveira et al. ، 2005 Özcan et al. ، 2019 Pastink et al. ، 2009). لمحاكاة المزارع قرب نهاية الدفعة ، قد لا يدعم معدل امتصاص الجلوكوز المنخفض معدل صيانة ATP الأصلي (مATP) القيود التي تؤدي إلى حل غير قابل للتنفيذ. في مثل هذه الحالات ، نظرًا لأغراض النمذجة ، قللنا تدريجيًا من مATP بقيمة 0.1 مليمول / جيجاواط / ساعة حتى يتم الحصول على محلول ممكن. مثل هذا الانخفاض في مATP تم عرضه مؤخرًا أيضًا في دراسة ، حيث L. اللاكتيس و ليو. ميسينتيرويدس في مفاعل retentostat كثقافة مشتركة ، و مATP انخفضت قيم كلا النوعين بمعدلات نمو منخفضة مقارنة بمعدلات النمو المرتفعة (van Mastrigt et al. ، 2019).

2.5 النمذجة الأيضية الديناميكية للثقافات النقية والمشتركة

تمت محاكاة ملامح تركيز الكتلة الحيوية والمستقلبات خارج الخلية للثقافات الدفعية من خلال نهج النمذجة الأيضية الديناميكية. تم تطبيق نهج تحليل توازن التدفق الديناميكي المستند إلى التحسين الثابت (Mahadevan et al. ، 2002) على الثقافة النقية لـ L. اللاكتيس subsp. كريموريس, L. اللاكتيس subsp. اللاكتيس, S. ثيرموفيلوس و ليو. ميسينتيرويدس، بينما تم تطبيق نهج النمذجة الأيضية للثقافة المشتركة الديناميكية (Hanemaaijer et al. ، 2017 Zhuang et al. ، 2011 ، 2012) وهو نهج dFBA مكيف للأنظمة متعددة الأنواع ، تم تطبيقه على الثقافات المشتركة (الشكل 1). في النماذج الديناميكية ، تمت كتابة موازين الكتلة التفاضلية للمستقلبات خارج الخلية التالية: المستقلبات التي تم قياسها تجريبيًا (الجلوكوز والأحماض العضوية والأحماض الأمينية) ، والمستقلبات الأخرى في وسط التخمير (الفيتامينات والأحماض النووية) والمستقلبات المعروفة بأنها تنتج (مركبات النكهة).

(1) (2) (3) (4)

تم حساب توزيع التدفق الأيضي في النماذج الديناميكية من خلال تحسينين متتاليين. الأولى هي مشكلة البرمجة الخطية (على سبيل المثال ، تحليل توازن التدفق ، FBA Orth et al. ، 2010) والتي تزيد من معدل النمو عن طريق تقييد النماذج بمصدر الكربون ومعدلات استخدام الأحماض الأمينية ، والتحسين الثانوي هو مشكلة البرمجة التربيعية (QP) التي تقلل المجموع الكلي للتدفقات المطلقة.تم تطبيق QP في تحليلات التدفق كتحسين ثانوي بعد يعتمد LP على مبدأ الحد الأدنى من استخدام موارد الإنزيم لتحقيق الهدف الأساسي ، كما أنه يساعد على تجنب مشكلة Optima البديلة (Lewis et al. ، 2010 Tarlak et al. ، 2014). تم إجراء تحليلات التدفق الأيضي باستخدام COBRA Toolbox (Schellenberger et al. ، 2011) في بيئة MATLAB ، مع Gurobi6 (//www.gurobi.com) باعتباره الحل الأمثل. تم حل مجموعات المعادلات التفاضلية العادية (ODE) في النماذج الديناميكية بواسطة ode45 ، وهي دالة MATLAB تعتمد على طريقة Runge-Kutta الرقمية. أخيرًا ، تم استخدام الكتلة الحيوية الأولية التي تم الحصول عليها تجريبياً وتركيزات المستقلب كظروف أولية لمحلول مجموعات ODE.

تم تقدير معلمات حركية امتصاص الركيزة في المعادلة (1) ديناميكيًا بواسطة أداة تحسين MEIGO (Egea et al. ، 2014). تم تقدير المعلمات الحركية الخاصة بالسلالة باستخدام تجارب الثقافة البحتة ، واستخدمت في كل من نماذج الثقافة البحتة والمشتركة.


التاريخ والكيمياء الحيوية للأغذية المخمرة

في حين أن عملية التخمير تسبق ظهور نوعنا بشكل كبير ، كان البشر يسخرون هذه التكنولوجيا الميكروبية لإنتاج الغذاء وحفظه لآلاف السنين. في كثير من الحالات ، يمكن أن تعمل الأطعمة المخمرة المحددة كعلامة على الهوية الثقافية ، وربما تجذبنا إلى نكهات ورائحة مطبخ الجدة. هنا ، سوف نتعمق في تاريخ وعلم الأطعمة المخمرة.

جزء من قطعة أثرية مصرية قديمة تصور زراعة العنب وصناعة النبيذ. المصدر: Egyptischer Maler um 1500 v. Chr. [المجال العام] ، عبر ويكيميديا ​​كومنز

لمحة تاريخية

في مفهوم الطهي ، التخمير هو تحويل وحفظ الطعام عن طريق البكتيريا. في حين أن عملية التخمير كممارسة طهي تعود إلى الحضارة الإنسانية المبكرة ، فقد استغرق الأمر وقتًا طويلاً قبل أن يتم فهم المبادئ العلمية (1). ومع ذلك ، فقد أظهرت الدراسات الأثرية أن تقنيات التخمير كانت مكونات راسخة في الحضارات القديمة ، وهناك دليل على أن مفهوم الثقافات "البادئة" كان موضع تقدير على نطاق واسع والحفاظ عليه (2-5). يسلط الجدول أدناه الضوء على بعض معالم التخمير في سياق أنثروبولوجيا الطهي:

معالم تخمير مختارة على مدى تاريخ البشرية. الجدول مقتبس من "تاريخ الأطعمة المخمرة." (2)

فجر الكيمياء الحيوية

لويس باستير ليس شابًا جدًا

على الرغم من التاريخ الأنثروبولوجي المذهل والغني الذي يحيط باستخدام التخمير لحفظ الطعام ، إلا أننا لم نبدأ في معرفة أن التخمير كان عملية استقلابية متأصلة في الكائنات الحية الدقيقة إلا في الآونة الأخيرة. عندما زرعت بذور علم الأحياء الدقيقة من خلال اكتشاف البكتيريا بواسطة أنطوني فان ليوينهوك (1683) ، بدأ المشروع العلمي الحديث في التبلور ، وكان التخمير في قلب هذه الحركة. في البداية ، كان من المفترض أن تسوس وموت الكائنات الحية الدقيقة أدى إلى ظهور الأطعمة المخمرة ، كما افترض الكيميائي الألماني Justus Von Liebig (6). ومع ذلك ، في عام 1857 ، قدم عالم فرنسي شاب اسمه لويس باستور ملاحظة مثيرة للاهتمام تتحدى هذه الفكرة & # 8212 وكان كل ذلك بسبب مشكلة في الإنتاج الصناعي لمشروب كحولي (7).

يعتبر عصير البنجر مشروبًا مخمرًا تاريخيًا

قبل عام من نشر باستير لهذه الملاحظات المهمة ، اتصل به أحد الصناعيين من ليل ، مسيو بيغو ، الذي صنع الكحول من عصير البنجر. لم يتم تحويل العديد من أحواض عصير البنجر من Bigo إلى كحول & # 8212 بدلاً من ذلك ، كان العصير حامضًا (أشبه بالخل). هذه الظاهرة هددت عمله ، لذلك جاء باستير للتحقيق.

استخدم باستور ، جزئيًا ، الفحص المجهري لفهم الأساس الكيميائي والبيولوجي للأطعمة المخمرة

باستخدام المجهر ، نظر باستير في عينات من الأوعية الناجحة (التي تحتوي على الكحول) ولاحظ وجود كريات دهنية لطيفة. ومع ذلك ، عند النظر إلى العينات الحامضة ، رأى فقط جزيئات رفيعة ممدودة. من خلال مزيد من الدراسة ، خلص أيضًا إلى أن العينة الحامضة تحتوي على حمض الأسيتيك ، وهو بالتأكيد ليس كحول!

للمساعدة في فهم هذا الاختلاف ، واصل توصيف الكحول المنتج على أنه تم تخمير عصير البنجر "بنجاح" ، ووجد باستير أن هذا المركب نشط بصريًا. كان قد درس بالفعل الكيمياء الفراغية لعدة سنوات ، وتشير ملاحظاته السابقة إلى أن جميع المركبات العضوية ذات النشاط البصري تتكون من كائنات حية (8). وهكذا توصل إلى استنتاج مفاده أن الخلايا الحية كانت مسؤولة عن عملية التمثيل الغذائي للتخمير:

ترتبط التغيرات الكيميائية للتخمير بنشاط حيوي ، يبدأ بالنشاط الأخير وينتهي به. أعتقد أن التخمر الكحولي لا يحدث أبدًا بدون التنظيم المتزامن ، التطور والتكاثر للخلايا أو الحياة المستمرة للخلايا التي تكونت بالفعل. كل النتائج في هذه الورقة تبدو لي مناقضة تمامًا لآراء ليبيج وبرزيليوس & # 8230 الآن & # 8230 في ماذا يتكون الفعل الكيميائي لتحلل السكر وما هو السبب الدقيق له؟ أعترف أنني ببساطة لا أعرف. & # 8212 لويس باستير (8)

استخدم باستير القوارير ذات عنق البجعة (يمينًا) لإثبات أن الجسيمات الحية من الهواء كانت مصدرًا للتلوث - بدلاً من نظرية التوليد التلقائي التي كانت موجودة سابقًا

واصل باستير دراسة التخمير واكتشف أن الخميرة تحول السكريات إلى كحول ، وأن التأثير "الحامض" لعصير البنجر كان نتيجة التلوث بأنواع بكتيرية قادرة على تحويل الإيثانول إلى حمض أسيتيك. للتخلص من الملوثات البكتيرية المحتملة ، ابتكر باستير تقنية يتم فيها تسخين العينات إلى درجة حرارة محددة لفترة زمنية محددة. هذه العملية ، المعروفة بالبسترة ، لا تزال مستخدمة على نطاق واسع حتى يومنا هذا.

بينما كان لا يزال هناك الكثير لنتعلمه ، كانت المبادئ الرئيسية لعمل باستير في التخمير رائدة. بناءً على هذه القصة العلمية ، كان موريتز تروب ، الكيميائي الألماني الذي اقترح في عام 1877 أن التخمير كان سلسلة من الأحداث الكيميائية حيث يتم نقل الأكسجين من جزء من جزيء السكر إلى جزء آخر ، مما يؤدي إلى منتج شديد التأكسد (CO2 ) ومنتج مخفض للغاية ( بمعنى آخر. كحول). علاوة على ذلك ، اقترح Traube أن كل حدث كيميائي في تسلسل التخمير يتم تحفيزه بواسطة مادة شبيهة بالبروتين (في إشارة إلى الإنزيمات) ، مما يوفر رؤى رائعة في الكيمياء الخلوية قبل الآخرين في هذا المجال (1). بعد عشرين عامًا ، أظهر إدوارد بوخنر ، وهو كيميائي ألماني أيضًا ، أن السكروز يمكن تخميره إلى كحول عن طريق مستخلصات الخميرة ، وصاغ مصطلح "زيماز" لوصف المركب الخلوي الذي يحفز هذا التحويل. كان عمل بوكنر يستحق جائزة نوبل في الكيمياء عام 1907 ، وقام بتعديل نموذج باستير للتأكيد على فكرة أن التخمير هو وظيفة حية ، ولكن ليس بالضرورة تقسيم الخلايا. علاوة على ذلك ، أظهر بوخنر أن التخمير هو سلسلة من الأحداث ، مع كل خطوة يتم تحفيزها بواسطة إنزيم مختلف (9).

من خلال عملهم على العملية العلمية للتخمير ، مهد باستور ، وتراوب ، وبوشنر ، وغيرهم الكثير ، الطريق لدراسة كيمياء الحياة ، والمعروفة باسم الكيمياء الحيوية ، مما أدى إلى فتح مجال علمي بأكمله.

التخمير: La vie sans l’air

من وجهة نظر الكيمياء الحيوية ، التخمير هو عملية التمثيل الغذائي التي يتم من خلالها تحويل المركبات العضوية إلى طاقة ، دون تدخل عامل مؤكسد. كما اقترح لويس باستور بإيجاز ، فإن التخمير هو " la vie sans l’air ، "أو" الحياة بدون هواء. " ومع ذلك ، فإن التخمير ليس مقاسًا واحدًا يناسب الجميع. هناك بالفعل تنوع مذهل عندما يتعلق الأمر بعمليات التخمير ، حيث تحتوي الكائنات الحية الدقيقة المختلفة على آليات مختلفة لتحويل الجلوكوز إلى طاقة.

في صميم التنفس الخلوي ، والذي يمكن أن يشمل التخمر ، هو عملية الحفاظ على درجة عالية من تحلل السكر. من خلال هذا التفاعل المكون من عشر خطوات ، ينقسم جزيء الجلوكوز إلى جزيئين من البيروفات. لا يحتاج تحلل السكر إلى الأكسجين ، وهو موجود في كل كائن حي على الأرض ، مما يشير إلى أنه كان أحد المسارات الكيميائية الحيوية الأولى التي تطورت. ومع ذلك ، فإن مصير البيروفات يتحدد بوجود أو عدم وجود الأكسجين. عند وجود الأكسجين ، متقبل الإلكترون ، ينتقل البيروفات إلى مسارات التنفس الخلوي الهوائية & # 8212 دورة كريبس وسلسلة نقل الإلكترون & # 8212 لتوليد ATP. ومع ذلك ، في حالة عدم وجود الأكسجين ، ستدخل جزيئات البيروفات في سلسلة التخمير.

طورت بعض الكائنات الحية الدقيقة مستوى من المرونة الأيضية ، مما يسمح لها بالتبديل بين التنفس الهوائي والتخمير. على هذا النحو ، يتم تصنيف هذه الكائنات الحية الدقيقة على أنها لا هوائية اختيارية. ومع ذلك ، فإن الكائنات الحية الدقيقة الأخرى تسمم بالأكسجين ، ويمكن أن تخضع فقط للتنفس اللاهوائي. في هذه الحالة ، الكائنات الحية الدقيقة تلزم اللاهوائية. لكل من اللاهوائيات الاختيارية واللاهوائية الملزمة ، تعمل عملية التخمير على إعادة تدوير نواتج تفاعل حال السكر ، مما يضمن أن الخلايا يمكن أن تستمر في إنتاج ATP.

ضع في اعتبارك صيغة تحلل السكر:

عندما لا يكون الأكسجين موجودًا ، فإن تحلل السكر هو آلية إنتاج الطاقة الأولية ، حيث يولد جزيئين صافين من ATP لكل جزيء من الجلوكوز. بالإضافة إلى الوصول إلى السكر ، يتطلب التحلل السكري أنزيم نيكوتيناميد الأدينين ثنائي النوكليوتيد (NAD). على وجه التحديد ، يتطلب إنزيم نازعة هيدروجين فوسفات الفوسفات الغليكوليدي (GAPDH) NAD + كعامل مساعد ، والذي يتم تقليله إلى NADH أثناء التفاعل الأنزيمي. ومع ذلك ، لا تحتوي الخلايا على كمية غير محدودة من NAD + ، مما يشكل مشكلة في إنتاج الطاقة. لذلك ، من المهم حقًا أن تمتلك الخلايا آليات تعمل على أكسدة NADH مرة أخرى إلى NAD +. في كثير من الكائنات الحية ، يتم تحقيق ذلك عن طريق التخمير.

تتعدد تطبيقات كيمياء التخمير وتتنوع وتتجاوز المطبخ. ومع ذلك ، لأغراض هذه المناقشة ، سنركز على تفاعلات التخمير التي يتم تسخيرها لوظائف الطهي ، وهي إنتاج حمض اللاكتيك والإيثانول.

التخمير بحمض اللاكتيك

يحدث تحويل البيروفات إلى حمض اللاكتيك مباشرة عن طريق التأثير الأنزيمي لنزعة هيدروجين اللاكتات. في هذا التفاعل ، يتم تقليل البيروفات إلى حمض اللاكتيك ، بينما يتم تجديد NAD + وإعادته مرة أخرى إلى مسار التحلل. ال اكتوباكيلل النظام ، المعروف أيضًا باسم بكتيريا حمض اللاكتيك (LAB) ، هو مجموعة من البكتيريا موجبة الجرام التي تنتج حمض اللاكتيك في نهاية شلالات تخمير الكربوهيدرات. يتم تسخير العديد من أنواع LAB لتخمير الطعام لأن تحمض بيئة النمو (الحليب ، محلول ملحي ، إلخ) يمنع نمو الكائنات الحية الدقيقة الأخرى التي يمكن أن "تفسد" الطعام. على هذا النحو ، تم استخدام تخمير حمض اللاكتيك من قبل عدد لا يحصى من الثقافات لعدة قرون لحفظ الطعام. في الآونة الأخيرة ، ثبت أن بكتيريا LAB هي جزء موجود في كل مكان من ملف تعريف البكتيريا الصحية في الأمعاء البشرية ، مما يساهم في سمعتها السيئة. الأطعمة الشائعة التي تحتوي على LAB هي الزبادي والكيمتشي ومخلل الملفوف وبيرة لامب.

تخمير الإيثانول

يحدث تحول البيروفات إلى إيثانول وثاني أكسيد الكربون على خطوتين. أولاً ، تتم إزالة مجموعة الكربوكسيل من البيروفات بواسطة بيروفات ديكاربوكسيلاز لإنتاج أسيتالديهيد وثاني أكسيد الكربون (هذه الخطوة هي السبب في إمكانية شرب المشروبات الكحولية). بعد ذلك ، يتم تحويل الأسيتالديهيد إلى إيثانول من خلال عمل نازعة هيدروجين الكحول ، والذي ينتج NAD + بالتوازي & # 8212 مما يوفر ركيزة ضرورية لاستمرار تحلل السكر. تعتبر الخميرة من اللاهوائيات الاختيارية مهمة جدًا لأنها فعالة جدًا في إنتاج الإيثانول ، مما يسمح للإنسان "بالتقاط الضجيج" عند شرب المشروبات مثل النبيذ والبيرة. علاوة على ذلك ، هذه العملية ضرورية لصنع الخبز. بينما يتم طهي غالبية الإيثانول من الخبز ، يتم إطلاق ثاني أكسيد الكربون2 أثناء عملية تخمير الإيثانول هو ما يجعل الرغيف رقيقًا.

من وجهة نظر الطهي ، هذا يخلق فرصة لإنشاء مجموعة واسعة من المنتجات الغذائية وملامح النكهات. لقد استمتع الكثير منا بثمار عمل الكائنات الحية الدقيقة ، ويقدر أن ما يصل إلى ثلث جميع الأطعمة التي يستهلكها البشر على كوكب الأرض يتم تخميرها (10). المخللات والزيتون والخبز والبيرة والنبيذ والشوكولاتة والقهوة والخل وصلصة الصويا ... كل هذه الأطعمة اللذيذة ، بالإضافة إلى العديد من أنواع الخميرة الأخرى ، هي نتيجة نقل البيروفات إلى سلسلة تخمير. في بعض الأحيان ، تستخدم مخمرات المطبخ عملية "تخمير بري" حيث يتم تسخير المجموعة الطبيعية من الكائنات الحية الدقيقة الموجودة في الأطعمة لخلق نتيجة طهي محددة. في أوقات أخرى ، يتم استخدام ثقافة بادئة محددة جيدًا ومميزة لإنشاء منتجات غذائية مخمرة محددة. تجدر الإشارة إلى أن التخمير مفيد في البيئات الصناعية أيضًا ، وتقوم العديد من شركات التكنولوجيا الحيوية بصب موارد لا تصدق في البحث والتطوير في مجال التخمير الصناعي ( بمعنى آخر. وقود حيوي).

بغض النظر عن الاستراتيجية ، من المهم أن نتذكر أن الكائنات الحية الدقيقة في الطبيعة لا توجد في الزراعة الأحادية & # 8212 بمعنى ، في أي بيئة بيئية معينة ، هناك مجموعة متنوعة من الكائنات الحية الدقيقة تعيش وتعمل معًا استجابة لظروفها البيئية.


حلول كتب علمية إضافية

علم الأحياء: وحدة وتنوع الحياة (قائمة الدورات MindTap)

علم الأحياء: العلم الديناميكي (قائمة المقررات الدراسية MindTap)

علم الأحياء البشري (قائمة الدورات MindTap)

الوراثة البشرية: المبادئ والقضايا (قائمة الدورات MindTap)

علم الأحياء: وحدة وتنوع الحياة (قائمة الدورات MindTap)

تشريح القلب والرئة وعلم وظائف الأعضاء

علم الأحياء (قائمة الدورات MindTap)

الكيمياء العامة - كتاب مستقل (قائمة المقررات MindTap)

علم المحيطات: دعوة إلى علوم البحار ، فيرسين ذو أوراق فضفاضة

التغذية: المفاهيم والخلافات - كتاب مستقل (MindTap Course List)

الفيزياء للعلماء والمهندسين: أسس وتواصل

العلوم البيئية (قائمة الدورات MindTap)

الفيزياء للعلماء والمهندسين

أسس علم الفلك (قائمة الدورات MindTap)

أساسيات الجغرافيا الطبيعية

الفيزياء للعلماء والمهندسين بالفيزياء الحديثة

التغذية خلال دورة الحياة

الكيمياء العضوية والبيولوجية

كيمياء اليوم: الكيمياء العامة والعضوية والكيمياء الحيوية

الكيمياء التمهيدية: مؤسسة

الكيمياء: المبادئ وردود الفعل

العلوم البيئية (قائمة الدورات MindTap)

الكيمياء والفاعلية الكيميائية أمبير

الكيمياء العامة والعضوية والبيولوجية

مقدمة في الكيمياء العامة والعضوية والحيوية

فهم التغذية (قائمة الدورات MindTap)

الكيمياء لطلاب الهندسة

الكيمياء لطلاب الهندسة

مقدمة في العلوم الفيزيائية

آفاق: استكشاف الكون (قائمة دورات MindTap)

الكيمياء: منهج الذرات أولاً

الفيزياء للعلماء والمهندسين ، تحديث التكنولوجيا (لم يتم تضمين رموز الوصول)


التخمير

العديد من الخلايا غير قادرة على التنفس بسبب واحد أو أكثر من الحالات التالية:

  1. تفتقر الخلية إلى كمية كافية من أي متقبل إلكتروني مناسب وغير عضوي نهائي لإجراء التنفس الخلوي.
  2. تفتقر الخلية إلى الجينات لصنع المجمعات المناسبة وحاملات الإلكترون في نظام نقل الإلكترون.
  3. تفتقر الخلية إلى الجينات لإنتاج إنزيم واحد أو أكثر في دورة كريبس.

في حين أن عدم وجود متقبل نهائي غير عضوي مناسب للإلكترون يعتمد على البيئة ، يتم تحديد الشرطين الآخرين وراثيًا. وهكذا ، فإن العديد من بدائيات النوى ، بما في ذلك أعضاء من الجنس المهم سريريًا العقدية، غير قادرة بشكل دائم على التنفس ، حتى في وجود الأكسجين. على العكس من ذلك ، فإن العديد من بدائيات النوى اختيارية ، مما يعني أنه في حالة تغير الظروف البيئية لتوفير متقبل إلكتروني نهائي غير عضوي مناسب للتنفس ، فإن الكائنات الحية التي تحتوي على جميع الجينات المطلوبة للقيام بذلك سوف تتحول إلى التنفس الخلوي من أجل استقلاب الجلوكوز لأن التنفس يسمح بـ ATP أكبر بكثير. الإنتاج لكل جزيء جلوكوز.

إذا لم يحدث التنفس ، يجب إعادة أكسدة NADH إلى NAD + لإعادة استخدامه كحامل إلكترون لتحلل السكر ، وهي الآلية الوحيدة للخلية لإنتاج أي ATP ، للمتابعة. تستخدم بعض الأنظمة الحية جزيءًا عضويًا (عادةً بيروفات) كمستقبل نهائي للإلكترون من خلال عملية تسمى التخمير. لا يتضمن التخمير نظام نقل الإلكترون ولا ينتج بشكل مباشر أي ATP إضافي أكثر من ذلك المنتج أثناء تحلل السكر عن طريق الفسفرة على مستوى الركيزة. الكائنات الحية التي تقوم بالتخمير ، والتي تسمى المخمرات ، تنتج كحد أقصى من جزيئي ATP لكل جلوكوز أثناء تحلل السكر. يقارن الجدول 1 متقبلات الإلكترون النهائية وطرق تخليق ATP في التنفس الهوائي والتنفس اللاهوائي والتخمير. لاحظ أن عدد جزيئات ATP الموضح لتحلل السكر يفترض أن مسار Embden-Meyerhof-Parnas. عدد جزيئات ATP المصنوعة بواسطة الفسفرة على مستوى الركيزة (SLP) عكس الفسفرة المؤكسدة (OP) يشار إلى.

تم التلاعب بعمليات التخمير الميكروبي من قبل البشر وتستخدم على نطاق واسع في إنتاج العديد من الأطعمة والمنتجات التجارية الأخرى ، بما في ذلك المستحضرات الصيدلانية. يمكن أن يكون التخمير الميكروبي مفيدًا أيضًا في تحديد الميكروبات لأغراض التشخيص.

التخمير بواسطة بعض البكتيريا ، مثل تلك الموجودة في اللبن ومنتجات غذائية حامضة أخرى ، وعن طريق الحيوانات في العضلات أثناء نضوب الأكسجين ، هو تخمير حمض اللاكتيك. يكون التفاعل الكيميائي لتخمير حمض اللاكتيك كما يلي:

البكتيريا من عدة أجناس إيجابية الجرام ، بما في ذلك اكتوباكيللوس, ليوكونوستوك، و العقدية، تُعرف مجتمعة باسم بكتيريا حمض اللاكتيك (LAB)، والسلالات المختلفة مهمة في إنتاج الغذاء. خلال زبادي و جبنه الإنتاج ، البيئة شديدة الحموضة الناتجة عن تخمير حمض اللاكتيك تفسد البروتينات الموجودة في الحليب ، مما يؤدي إلى تصلبها. عندما يكون حمض اللاكتيك هو منتج التخمير الوحيد ، يُقال إن العملية كذلك التخمير المثلي هذا هو الحال بالنسبة ل Lactobacillus delbrueckii و المحبة للحرارة S. تستخدم في إنتاج الزبادي. ومع ذلك ، تؤدي العديد من البكتيريا التخمير غير المتجانس، لإنتاج خليط من حمض اللاكتيك والإيثانول و / أو حمض الأسيتيك وثاني أكسيد الكربون2 نتيجة لذلك ، بسبب استخدامها لمسار فوسفات البنتوز المتفرّع بدلاً من مسار النبضات الكهرومغناطيسية لتحلل السكر. واحد مهم هو التخمير غير المتجانسة Leuconostoc mesenteroides، والذي يستخدم لتخمير الخضروات مثل الخيار والملفوف ، وإنتاج المخللات ومخلل الملفوف ، على التوالي.

تعتبر بكتيريا حمض اللاكتيك مهمة أيضًا من الناحية الطبية.إن إنتاج بيئات منخفضة الأس الهيدروجيني داخل الجسم يمنع تكوين ونمو مسببات الأمراض في هذه المناطق. على سبيل المثال ، تتكون الجراثيم المهبلية بشكل كبير من بكتيريا حمض اللاكتيك ، ولكن عندما يتم تقليل هذه البكتيريا ، يمكن أن تتكاثر الخميرة ، مما يسبب عدوى الخميرة. بالإضافة إلى ذلك ، تعد بكتيريا حمض اللاكتيك مهمة في الحفاظ على صحة الجهاز الهضمي ، وبالتالي فهي المكون الأساسي للبروبيوتيك.

عملية التخمير المألوفة الأخرى هي تخمير الكحولالتي تنتج الإيثانول. يظهر تفاعل تخمر الإيثانول في الشكل 1. في التفاعل الأول ، الإنزيم بيروفات ديكاربوكسيلاز يزيل مجموعة الكربوكسيل من البيروفات ، ويطلق ثاني أكسيد الكربون2 الغاز أثناء إنتاج جزيء ثنائي الكربون أسيتالديهيد. التفاعل الثاني ، المحفز بواسطة إنزيم نازع هيدروجين الكحول ، ينقل إلكترونًا من NADH إلى الأسيتالديهيد ، وينتج الإيثانول و NAD +. تخمر الإيثانول من البيروفات بواسطة الخميرة خميرة الخميرة يستخدم في إنتاج المشروبات الكحولية ويؤدي أيضًا إلى ارتفاع منتجات الخبز بسبب ثاني أكسيد الكربون2 إنتاج. خارج صناعة المواد الغذائية ، يعتبر تخمير الإيثانول للمنتجات النباتية مهمًا في وقود حيوي إنتاج.

الشكل 1. التفاعلات الكيميائية لتخمير الكحول موضحة هنا. تخمير الإيثانول مهم في إنتاج المشروبات الكحولية والخبز.

إلى جانب تخمير حمض اللاكتيك وتخمير الكحول ، تحدث العديد من طرق التخمير الأخرى في بدائيات النوى ، وكل ذلك لغرض ضمان إمداد كافٍ من NAD + لتحلل السكر (الجدول 2). بدون هذه المسارات ، لن يحدث تحلل الجلوكوز ولن يتم حصاد ATP من انهيار الجلوكوز. وتجدر الإشارة إلى أن معظم أشكال التخمير بجانبها التخمير المثلي تنتج الغاز ، عادة ثاني أكسيد الكربون2 و / أو غاز الهيدروجين. تُستخدم العديد من هذه الأنواع المختلفة من مسارات التخمير أيضًا في إنتاج الغذاء ويؤدي كل منها إلى إنتاج أحماض عضوية مختلفة ، مما يساهم في النكهة الفريدة لمنتج غذائي معين. ينتج حمض البروبيونيك أثناء تخمير حمض البروبيونيك يساهم في النكهة المميزة للجبن السويسري على سبيل المثال.

العديد من منتجات التخمير مهمة تجاريًا خارج صناعة الأغذية. على سبيل المثال ، المذيبات الكيميائية مثل الأسيتون و البيوتانول يتم إنتاجها خلال تخمير الأسيتون - البيوتانول - الإيثانول. يتم إنتاج المركبات الصيدلانية العضوية المعقدة المستخدمة في المضادات الحيوية (مثل البنسلين) واللقاحات والفيتامينات من خلال التخمير الحمضي المختلط. تستخدم منتجات التخمير في المختبر لتمييز البكتيريا المختلفة لأغراض التشخيص. على سبيل المثال ، تُعرف البكتيريا المعوية بقدرتها على إجراء التخمر الحمضي المختلط ، مما يقلل من الرقم الهيدروجيني ، والذي يمكن اكتشافه باستخدام مؤشر الأس الهيدروجيني. وبالمثل ، يمكن أيضًا اكتشاف الإنتاج البكتيري للأسيتوين أثناء تخمير البوتانيديول. يمكن أيضًا رؤية إنتاج الغاز من التخمر في أنبوب دورهام المقلوب الذي يحبس الغاز المنتج في مزرعة المرق.

يمكن أيضًا تمييز الميكروبات وفقًا للركائز التي يمكن أن تخمرها. على سبيل المثال، بكتريا قولونية يمكن أن يخمر اللاكتوز ، مكونًا غازات ، في حين أن بعض أقاربه من سالب الجرام لا يستطيعون ذلك. تُستخدم القدرة على تخمير السوربيتول الكحولي للسكر لتحديد سلالة النزف المعوي O157: H7 المسببة للأمراض. بكتريا قولونية لأنه ، على عكس الآخرين بكتريا قولونية سلالات ، فإنه غير قادر على تخمير السوربيتول. أخيرًا ، يميز تخمير المانيتول تخمر المانيتول المكورات العنقودية الذهبية من المكورات العنقودية الأخرى غير المخمرة للمانيتول.

الجدول 2. مسارات التخمير المشتركة
مسار المنتجات النهائية مثال الميكروبات المنتجات التجارية
أسيتون - بيوتانول - إيثانول الأسيتون ، البيوتانول ، الإيثانول ، أول أكسيد الكربون2 المطثية acetobutylicum المذيبات التجارية والبنزين البديل
كحول الإيثانول ، كو2 المبيضات ، السكريات بيرة ، خبز
بوتانيديول حمض الفورميك واللاكتيك إيثانول أسيتوين 2،3 بوتانديول CO2 غاز الهيدروجين كليبسيلا ، جرثومة الأمعاء نبيذ شاردونيه
حمض البيوتيريك حمض الزبد ، أول أكسيد الكربون2، غاز الهيدروجين المطثية الزبدية سمنة
حمض اللاكتيك حمض اللاكتيك العقدية ، الملبنة مخلل الملفوف واللبن والجبن
حمض مختلط أحماض الأسيتيك والفورميك واللاكتيك والسكسينيك ، الإيثانول ، أول أكسيد الكربون2، غاز الهيدروجين الإشريكية ، الشيغيلة الخل ومستحضرات التجميل والأدوية
حمض البروبيونيك حمض الخليك ، حمض البروبيونيك ، أول أكسيد الكربون2 Propionibacterium ، Bifidobacterium جبنة سويسرية

فكر في الأمر

  • متى يقوم الميكروب متعدد الاستخدامات الأيضي بالتخمير بدلاً من التنفس الخلوي؟

التعرف على البكتيريا باستخدام لوحات اختبار API

يعد التعرف على العزلة الميكروبية أمرًا ضروريًا للتشخيص المناسب والعلاج المناسب للمرضى. طور العلماء تقنيات تحدد البكتيريا وفقًا لخصائصها البيوكيميائية. عادةً ما يقومون إما بفحص استخدام مصادر كربونية معينة كركائز للتخمير أو تفاعلات أيضية أخرى ، أو يقومون بتحديد منتجات التخمير أو إنزيمات معينة موجودة في التفاعلات. في الماضي ، استخدم علماء الأحياء الدقيقة أنابيب وألواح اختبار فردية لإجراء الاختبارات الكيميائية الحيوية. ومع ذلك ، فإن العلماء ، وخاصة أولئك الذين يعملون في المختبرات السريرية ، يستخدمون الآن بشكل متكرر ألواح بلاستيكية يمكن التخلص منها ومتعددة الاختبارات تحتوي على عدد من أنابيب التفاعل المصغرة ، كل منها يشتمل عادةً على ركيزة محددة ومؤشر الأس الهيدروجيني. بعد تلقيح لوحة الاختبار بعينة صغيرة من الميكروب المعني والحضانة ، يمكن للعلماء مقارنة النتائج بقاعدة بيانات تتضمن النتائج المتوقعة لتفاعلات كيميائية حيوية محددة للميكروبات المعروفة ، وبالتالي تمكين التحديد السريع لعينة الميكروب. سمحت لوحات الاختبار هذه للعلماء بتقليل التكاليف مع تحسين الكفاءة وإمكانية التكاثر من خلال إجراء عدد أكبر من الاختبارات في وقت واحد.

تغطي العديد من لوحات الاختبار البيوكيميائية التجارية المصغرة عددًا من المجموعات المهمة سريريًا من البكتيريا والخمائر. واحدة من أقدم لوحات الاختبار وأكثرها شعبية هي لوحة فهرس الملف التحليلي (API) التي تم اختراعها في السبعينيات. بمجرد إجراء بعض الخصائص المختبرية الأساسية لسلالة معينة ، مثل تحديد شكل الجرام للسلالة ، يمكن استخدام شريط اختبار مناسب يحتوي على 10 إلى 20 اختبارًا كيميائيًا حيويًا مختلفًا لتمييز السلالات داخل تلك المجموعة الميكروبية. حاليا مختلف شرائط API يمكن استخدامها للتعرف بسرعة وسهولة على أكثر من 600 نوع من البكتيريا ، الهوائية واللاهوائية على حد سواء ، وما يقرب من 100 نوع مختلف من الخمائر. بناءً على ألوان التفاعلات عند وجود المنتجات النهائية الأيضية ، نظرًا لوجود مؤشرات الأس الهيدروجيني ، يتم إنشاء ملف تعريف التمثيل الغذائي من النتائج (الشكل 2). يمكن لعلماء الأحياء الدقيقة بعد ذلك مقارنة ملف تعريف العينة بقاعدة البيانات لتحديد الميكروب المحدد.

الشكل 2. يستخدم شريط اختبار API 20NE لتحديد سلالات معينة من البكتيريا سالبة الجرام خارج Enterobacteriaceae. فيما يلي نتيجة شريط اختبار API 20NE لـ Photobacterium damselae ssp. بيسيسيدا.

التركيز السريري: أليكس ، الجزء الثاني

يُكمل هذا المثال قصة أليكس التي بدأت في موضوع الطاقة والإنزيمات.

تتوافق العديد من أعراض أليكس مع العديد من أنواع العدوى المختلفة ، بما في ذلك الإنفلونزا والالتهاب الرئوي. ومع ذلك ، فإن ردود أفعاله البطيئة جنبًا إلى جنب مع حساسيته للضوء وتيبس رقبته توحي ببعض التورط المحتمل للجهاز العصبي المركزي ، مما قد يشير إلى التهاب السحايا. التهاب السحايا هو عدوى تصيب السائل الدماغي الشوكي (CSF) حول الدماغ والنخاع الشوكي وتسبب التهاب السحايا ، وهي الطبقات الواقية التي تغطي الدماغ. يمكن أن يحدث التهاب السحايا بسبب الفيروسات أو البكتيريا أو الفطريات. على الرغم من أن جميع أشكال التهاب السحايا خطيرة ، إلا أن التهاب السحايا الجرثومي خطير بشكل خاص. قد يكون التهاب السحايا الجرثومي ناتجًا عن عدة بكتيريا مختلفة ، ولكن البكتيريا النيسرية السحائية، سالبة الجرام ، على شكل حبة الفول ، هي سبب شائع وتؤدي إلى الوفاة في غضون يوم إلى يومين في 5 ٪ إلى 10 ٪ من المرضى.

نظرًا للخطورة المحتملة لظروف أليكس ، نصح طبيبه والديه بنقله إلى المستشفى في العاصمة الغامبية بانجول وهناك فحصه وعلاجه من التهاب السحايا المحتمل. بعد 3 ساعات بالسيارة إلى المستشفى ، تم إدخال أليكس على الفور. أخذ الأطباء عينة دم وأجروا ثقبًا في أسفل الظهر لاختبار السائل الدماغي النخاعي. كما بدأوه على الفور في تناول جرعة من المضاد الحيوي سيفترياكسون ، وهو الدواء المفضل لعلاج التهاب السحايا الناجم عن N. السحائية، دون انتظار نتائج الفحوصات المخبرية.

  • كيف يمكن استخدام الاختبارات البيوكيميائية لتأكيد هوية N. السحائية?
  • لماذا قرر أطباء أليكس إعطاء المضادات الحيوية دون انتظار نتائج الاختبار؟

سنعود إلى مثال أليكس في الصفحات اللاحقة.

المفاهيم الأساسية والملخص

  • يستخدم التخمير جزيءًا عضويًا كمستقبل نهائي للإلكترون لتجديد NAD + من NADH بحيث يمكن أن يستمر تحلل السكر.
  • لا يتضمن التخمير نظام نقل الإلكترون ، ولا يتم إجراء ATP بواسطة عملية التخمير مباشرة. تنتج المخمرات القليل جدًا من ATP - جزيئين فقط من ATP لكل جزيء جلوكوز أثناء تحلل السكر.
  • تم استخدام عمليات التخمير الميكروبي لإنتاج الأطعمة والمستحضرات الصيدلانية وللتعرف على الميكروبات.
  • أثناء تخمير حمض اللاكتيك ، يقبل البيروفات الإلكترونات من NADH ويختزل إلى حمض اللاكتيك. أداء الميكروبات التخمير المثلي إنتاج حمض اللاكتيك فقط كما تقوم الميكروبات المنتج التخمير التخمير غير المتجانس إنتاج خليط من حمض اللاكتيك والإيثانول و / أو حمض الأسيتيك وثاني أكسيد الكربون2.
  • يمنع إنتاج حمض اللاكتيك بواسطة الجراثيم الطبيعية نمو مسببات الأمراض في مناطق معينة من الجسم وهو مهم لصحة الجهاز الهضمي.
  • أثناء تخمير الإيثانول ، يتم أولاً نزع الكربوكسيل من البيروفات (إطلاق ثاني أكسيد الكربون2) إلى الأسيتالديهيد ، والذي يقبل بعد ذلك الإلكترونات من NADH ، مما يقلل الأسيتالديهيد إلى الإيثانول. يستخدم تخمير الإيثانول لإنتاج المشروبات الكحولية ، ولزيادة منتجات الخبز ، وإنتاج الوقود الحيوي.
  • توفر منتجات التخمر للمسارات (على سبيل المثال ، تخمير حمض البروبيونيك) نكهات مميزة للمنتجات الغذائية. يستخدم التخمير لإنتاج المذيبات الكيميائية (تخمير الأسيتون - البيوتانول - الإيثانول) والمستحضرات الصيدلانية (التخمير الحمضي المختلط).
  • يمكن تمييز أنواع معينة من الميكروبات من خلال مسارات التخمير ومنتجاتها. يمكن أيضًا تمييز الميكروبات وفقًا للركائز التي يمكنها تخميرها.

متعدد الخيارات

أي مما يلي هو الغرض من التخمير؟

  1. لصنع ATP
  2. لجعل جزيء الكربون وسيطة من أجل الابتنائية
  3. لجعل NADH
  4. لجعل NAD +

[كشف-answer q = & # 8221994743 & # 8243] إظهار الإجابة [/كشف-answer]
[hidden-answer a = & # 8221994743 & # 8243] الإجابة د. الغرض من التخمير هو جعل NAD +. [/ hidden-answer]

ما الجزيء الذي يعمل عادةً كمستقبل الإلكترون النهائي أثناء التخمير؟

[كشف-answer q = & # 8221887966 & # 8243] إظهار الإجابة [/كشف-answer]
[hidden-answer a = & # 8221887966 & # 8243] إجابة ج. عادةً ما يعمل البيروفات كمستقبل نهائي للإلكترون أثناء التخمير. [/ hidden-answer]

ما هو منتج التخمير المهم لجعل الخبز يرتفع؟

[كشف-answer q = & # 8221238691 & # 8243] إظهار الإجابة [/كشف-answer]
[hidden-answer a = & # 8221238691 & # 8243] الإجابة ب. كو2 مهم لصنع الخبز. [/ hidden-answer]

أي مما يلي ليس منتج تخمير مهم تجاريًا؟

[كشف-answer q = & # 8221836432 & # 8243] إظهار الإجابة [/كشف-answer]
[hidden-answer a = & # 8221836432 & # 8243] الإجابة ب. بيروفات ليس منتج تخمير مهم تجاريًا. [/ hidden-answer]

املاء الفراغ

الميكروب المسؤول عن تخمير الإيثانول لغرض إنتاج المشروبات الكحولية هو ________.

[كشف-answer q = & # 8221205075 & # 8243] إظهار الإجابة [/كشف-answer]
[hidden-answer a = & # 8221205075 & # 8243] الميكروب المسؤول عن تخمير الإيثانول لغرض إنتاج المشروبات الكحولية هو خميرة (خميرة الخميرة). [/ إجابة مخفية].

________ ينتج عنه إنتاج خليط من منتجات التخمير ، بما في ذلك حمض اللاكتيك ، والإيثانول و / أو حمض الأسيتيك ، وثاني أكسيد الكربون.2.

[كشف-answer q = & # 8221513820 & # 8243] إظهار الإجابة [/كشف-answer]
[hidden-answer a = & # 8221513820 & # 8243]التخمير غير المتجانس ينتج عنه إنتاج خليط من منتجات التخمير ، بما في ذلك حمض اللاكتيك ، والإيثانول و / أو حمض الأسيتيك ، وثاني أكسيد الكربون.2. [/ إجابة مخفية].

الكائنات الحية المخمرة تجعل ATP من خلال عملية ________.

[كشف-answer q = & # 822193931 & # 8243] إظهار الإجابة [/كشف-answer]
[hidden-answer a = & # 822193931 & # 8243] تجعل الكائنات المخمرة ATP من خلال عملية تحلل السكر. [/ إجابة مخفية].

مطابقة

طابق مسار التخمير مع المنتج التجاري الصحيح الذي يستخدم في إنتاجه:

___ تخمير الأسيتون - البيوتانول - الإيثانول أ. خبز
___ تخمير الكحول ب. الأدوية
___ تخمير حمض اللاكتيك ج. جبنة سويسرية
___ التخمر الحمضي المختلط د. زبادي
___ تخمير حمض البروبيونيك ه. مذيبات صناعية

[كشف-answer q = & # 8221283653 & # 8243] إظهار الإجابة [/كشف-answer]
[hidden-answer a = & # 8221283653 & # 8243]

  1. يتم إنتاج المذيبات الصناعية عن طريق تخمير الأسيتون - البيوتانول - الإيثانول.
  2. يتم إنتاج الخبز عن طريق تخمير الكحول.
  3. يتم إنتاج الزبادي عن طريق تخمير حمض اللاكتيك.
  4. يتم إنتاج الأدوية عن طريق التخمير الحمضي المختلط.
  5. يتم إنتاج الجبن السويسري عن طريق تخمير حمض البروبيونيك.

فكر في الأمر

  1. لماذا بعض الميكروبات منها العقدية spp. ، غير قادر على أداء التنفس الهوائي ، حتى في وجود الأكسجين؟
  2. كيف يمكن استخدام التخمير للتمييز بين أنواع مختلفة من الميكروبات؟
  3. البكتيريا بكتريا قولونية قادر على إجراء التنفس الهوائي ، والتنفس اللاهوائي ، والتخمير. متى ستؤدي كل عملية ولماذا؟ كيف يتم صنع ATP في كل حالة؟

رحلة الحمضية

الشيء ذاته الذي يعيق الإنتاج الناجح للمواد الكيميائية الخضراء من الكتلة الحيوية هو الذي أدى لسنوات إلى إبطاء المعالجة الكيميائية الحيوية التجارية من الكتلة الحيوية إلى الإيثانول.

يسميها البعض آلية الدفاع الذكي للبيولوجيا ضد المتسللين والمحللات الميكروبية. يقول دينيس ميللر ، أستاذ الهندسة الكيميائية في جامعة ولاية ميتشيغان: "إنها مادة هيكلية للطبيعة ، وقد تم تجميعها معًا بشكل آمن للغاية". يعد تفكيك المواد النباتية ، وفصل اللجنين عن السليلوز والهيميسليلوز من أجل استخدام السكريات المكونة من خمسة وستة كربون ، أكثر تعقيدًا من الأشكال الأخرى لاستخدام الكتلة الحيوية ، مثل تقطيع الخشب وحرقه في غلاية تعمل بالوقود الصلب. يقول لي ليند ، الأستاذ بكلية دارتموث ، إن "تمرد الكتلة الحيوية السليلوزية" هو أكبر عقبة أمام التنقية البيولوجية الفعالة من حيث التكلفة. "إذا تم حل هذا ، فإن تحويل السكريات إلى إيثانول واستعادة الإيثانول أمر راسخ" ، كما يقول. "بالنسبة للأحماض العضوية ، هناك المزيد من التحديات بما في ذلك عيار التخمير واستعادة المنتج."

يعتبر بعض الخبراء أن فئة المركبات المعروفة باسم الأحماض العضوية هي واحدة من أكثر مجموعات المنتجات الواعدة التي تنشأ من تخمير الكتلة الحيوية. حددت دراسة المختبر الوطني للطاقة المتجددة التي أجريت قبل بضع سنوات أن ثمانية من أفضل 12 مادة كيميائية ذات قيمة مضافة من السكريات على أنها أحماض كربوكسيلية. حمض الخليك مثال على حمض الكربوكسيل. عندما يتفاعل الكحول مع حمض يصنع استر. أحد الإستر الشائع في عالم الوقود المتجدد اليوم هو وقود الديزل الحيوي - الميثانول الذي يتفاعل مع الأحماض الدهنية لإنتاج استرات الميثيل.

إن منتجي الإيثانول المطحون بالذرة على دراية تامة ببكتيريا اللاكتيك وحمض الخليك ، والتي تتسلل خلسة إلى عملية إنتاج الإيثانول وتخمر السكريات إلى أحماض بدلاً من الكحول ، مما يؤدي إلى حرمان السكريات من العناصر الغذائية والمعادن الحيوية ، وبالتالي تقليل المحصول وإنتاج الطحن إلى توقف حتى يتم السيطرة على التلوث. في مصنع إيثانول الذرة ، يتم استخدام اثنين فقط من المخمرات الضخمة في مصافي التكرير العملاقة ، ولكن من المحتمل أن تحتوي مصفاة الكيمياء الحيوية الليجنوسليلوزية على العديد من المخمرات ، وفقًا لتقرير مقاولين من الباطن تم إجراؤه لـ NREL بواسطة Lynd et al ، بعنوان "تحليل مصفاة بيولوجية استراتيجية: تحليل من Biorefineries. " يقرأ ، "عدد المخمرات في حتى معمل تكرير حيوي متوسط ​​الحجم كبير جدًا - أكبر من 25 للعديد من التصميمات - أن تكلفة سعة التخمير لا تعتمد على ما إذا كانت هذه السعة مخصصة لمنتج واحد أو لعدة منتجات." بالنظر إلى ذلك ، يمكن لمصفاة حيوية بسهولة أن تكرس مخمرًا للإنتاج الكيميائي الحيوي لحمض اللاكتيك أو الخليك أو السكسينيك ، والذي يمكن بيعه في السوق المفتوحة على هذا النحو ، أو التفاعل مع تيار منزلق من المنتج الأساسي للمصفاة الحيوية ، الإيثانول ، لصنع مجموعة متنوعة من الاسترات المفيدة.

إيثيل لاكتات عن طريق التقطير التفاعلي
بالنسبة للشركات التي تطور الإيثانولوجيات لتخمير كل من السكريات المكونة من خمسة وستة كربون ، فإن ما يجب التعامل معه هو الميل الطبيعي لهذه الوحوش إلى الرغبة في إنتاج الأحماض. طورت شركة تدعى TMO Renewables Ltd. كائنًا حيًا لديه شهية لخمسة وستة من السكريات الكربونية ، و "أوقف" الجينات في الكائن الحي التي تنتج أحماض اللاكتيك والأسيتيك.

يقول كارل ليرا ، أستاذ الهندسة الكيميائية والديناميكا الحرارية في جامعة ولاية ميشيغان ، "عندما تنظر إلى بعض الكائنات الحية الموجودة هناك ، فإن بعض المنتجات الشائعة التي يمكنك الحصول عليها والتي صممتها الطبيعة بالفعل هي تخمير الأحماض". "بدلاً من محاولة جعل الكائن الحي يصنع منتجًا آخر ، دعه يصنع الحمض العضوي الذي يريد صنعه ومن ثم يمكننا معرفة كيفية تحويل ذلك إلى مواد وسيطة أخرى." وهذا بالضبط ما فعله ليرا وميلر وأساتذة جامعة ولاية ميشيغان ، جنبًا إلى جنب مع ريتشارد جلاس ، نائب رئيس البحث والتطوير في الرابطة الوطنية لمزارعي الذرة.

يقول جلاس: "ألن يكون رائعًا لو استطعنا أخذ منتج يتم إنتاجه حاليًا بواسطة صناعة البتروكيماويات وإيجاد نظير منافس له - منتج متجدد وتنافسي وصديق للبيئة". "كانت هذه مهمتنا. لقد وضعنا النظام النموذجي هناك لأن إيثيل لاكتات ينتج تجاريًا اليوم من البتروكيماويات ، ونحن نعرف بالضبط تكلفة هذا النموذج لأن النموذج موجود." بدأ مشروع MSU-NCGA في اتجاه مجرى التخمير وتضمن تفاعل تدفقات منفصلة من حمض اللاكتيك والإيثانول. في نهاية المطاف ، كان الباحثون يعتزمون ترخيص التعديل التحديثي لمصانع الإيثانول للذرة الجافة المطحونة لتنويع خط منتجاتهم الضيق ، ولكنه أيضًا قابل للتطبيق تمامًا على مفهوم المصفاة الحيوية lignocellulosic. يقول ميلر: "إن عمليتنا مستقلة عن المواد الأولية". "لا يهم إذا كنا نستخدم الجلوكوز من حبوب الذرة لصنع حمض اللاكتيك أو إذا استخدمنا السكريات من مخلفات الذرة أو الكتلة الحيوية الخشبية. تيار السكر المستخدم في صنع الإيثانول هو نفس تيار السكر الذي نستخدمه لصنع أحماض اللبنيك . "

إيثيل لاكتات هو مركب استر مشتق من تفاعل الإيثانول مع حمض اللاكتيك. وفقًا لـ Lira ، لا يستخدم الإيثيل لاكتات على نطاق واسع اليوم بسبب تكلفته العالية ، ولكن له تطبيقات في صناعة الإلكترونيات لتصنيع الدوائر الدقيقة ، ويرجع ذلك أساسًا إلى أنه مذيب نظيف. يقول ليرا إنه خلال الوقت الذي كان يعمل فيه هو وزملاؤه في هذا المشروع ، الذي نُشرت نتائجه في عام 2007 ، كانت تكلفة إنتاج إيثيل لاكتات بين 1.30 دولارًا و 1.60 دولارًا للرطل. تمكن باحثو MSU و NCGA من خفض هذه التكلفة إلى النصف باستخدام عملية تسمى التقطير التفاعلي.

يقول جلاس لمجلة Biomass Magazine: "كان التقطير التفاعلي موجودًا منذ فترة طويلة - إنه ليس جديدًا". "ولكن الجديد هو تطبيقنا. بشكل عام ، المشاكل المتعلقة بردود الفعل هي أنه لفصلها يجب عليك تقطيرها ، وعندما تقوم بتقطيرها يكون لديك نقاط غليان قريبة جدًا من بعضها البعض ، ومن الصعب جدًا فصلها. ولكن التقطير التفاعلي يسمح لنا لإنتاج مركبات تسمى hemiacetals ، وهي مستقرة في النظام ولها نقاط غليان مختلفة تمامًا عما قد تكون عليه للمادة الكيميائية الأصلية. " وهكذا ، بمجرد اكتمال التقطير يمكن تكسير نصف الأسيتال واستعادة المركب النقي بنسبة عالية من النقاء.

يسمي الزجاج الكيمياء المستخدمة في التقطير التفاعلي "أنيقة" لأنها فعالة وبسيطة بشكل غير عادي. يقول ميلر من وجهة نظر المعدات والطاقة ، أن التقطير التفاعلي هو وسيلة فعالة لتنفيذ عدد من التفاعلات الكيميائية. يقول ميلر: "إذا نظرت إلى المعالجة التقليدية ، فإن التفاعل يذهب جزئيًا ثم يتوقف ، ثم يتوقف ، ويتوقف ، والفكرة مع التقطير التفاعلي هي أنك تستمر في دفع التفاعل حتى اكتماله".

يتم استخدام نوعين من التغذية على الأقل في عمود التقطير التفاعلي ، مع أقل تفاعل متطاير ، وهو الحمض ، الذي يدخل الجزء العلوي ويدخل الإيثانول الأكثر تطايرًا إلى القاع. الهدف هو توفير منطقة تفاعلية حيث يتحرك الإستر والماء الناتج في اتجاهين متعاكسين في العمود. تتطلب هذه العملية عمودين لأنه في محلول حمض اللاكتيك يشكل أوليغومرات ، ويلاحظ الباحثون أن النمذجة الدقيقة لسلوك أوليغومر وتوازن طور الخليط هي جوانب لا يتجزأ من تصميم هذا المشروع بالذات. تسعى NCGA حاليًا إلى البحث عن الشركات التي قد تكون مهتمة بشراء ترخيص لعملية إنتاج الإيثيل لاكتات هذه ، والتي يمكن تعديلها في مصنع الإيثانول الجاف المطحون.

الأسواق وتنوع المنتجات
يقول جلاس: "إذا كان كل ما تنتجه من معمل تكرير حيوي هو الإيثانول ، فهذا جيد بالنسبة لصناعة ناشئة ، ولكن في جوهره ، كل ما لديك هو حصان صغير". "حلمي هو المصفاة الحيوية المتكاملة حيث الحدود الوحيدة هي خيالك وقدرتك على صنع النظام." تقول ليرا إن مصافي الإيثانول أحادية البعد. يقول: "في معمل التكرير الحيوي ، تريد حقًا هذا التنوع". "لكن الكثير من الجهد الآن هو صنع كائن حي واحد - لصنع منتج واحد - لأن هذا يبسط الفصل في اتجاه مجرى النهر ، وإذا كان بإمكانك صنع الإيثانول فقط ، فيمكنك تحويل التصميم إلى نظام متكامل." لم ترتبط كلمة "تسليم المفتاح" بمصافي إيثانول الكتلة الحيوية كما هو الحال في صناعة الإيثانول القائمة على النشا.

مثال كلاسيكي: ميثيل أسيتات مقابل إيثيل لاكتات

يقارن هذا الرسم البياني الاختلافات الرئيسية في تدفق العملية والتصميم المستخدم في التصنيع البتروكيماوي لإيثيل لاكتات ، يسارًا ، مقابل عملية التقطير التفاعلي الأبسط بكثير ، إلى اليمين.
المصدر: جامعة ولاية ميشيغان

يقول الزجاج من مصنع إيثانول بسعة 25 مليون ملي مولاري ، أن تيارًا جانبيًا من الإيثانول يبلغ 1 مليون ملي مولاري ، يتم تحويله لإنتاج مواد كيميائية مثل إيثيل لاكتات ، يمكن أن يحقق نفس القدر من الإيرادات مثل 24 مليون مكي من الإيثانول المتبقي المباع كوقود. قد يتساءل المرء لماذا لا يتم تحويل المزيد من الإيثانول وإنتاج المزيد من المواد الكيميائية ذات القيمة المضافة بدلاً من إنتاج الإيثانول الأقل قيمة. المشكلة في ذلك هي أن الأسواق هشة وما قد يعتبره البعض زيادات صغيرة في الإنتاج يمكن أن يؤدي إلى انخفاض الأسعار بشكل كبير. يبلغ استخدام إيثيل لاكتات في الولايات المتحدة ، على سبيل المثال ، ما بين 10 ملايين و 20 مليون جنيه إسترليني سنويًا ، ويباع بحوالي 1.50 دولارًا للرطل وفقًا لـ MSU. "ضع في اعتبارك أن هناك بعض اللاعبين الكبار هناك وإذا دخلت وحاولت إبعاد السوق عنهم ، فما الذي سيحاولون فعله؟" يطرح الزجاج. "لن يكونوا سعداء". Natureworks LLC تدير أكبر مصنع في العالم لحمض عديد حمض اللبنيك في بلير ، نيب. ، والذي ينتج 300 مليون جنيه إسترليني سنويًا.

وفقًا لتقرير بعنوان "إنتاج حمض السكسينيك وسوقه في الصين" ، تنتج الصين حوالي ربع إلى ثلث حمض السكسينيك في العالم. يقول التقرير إن طرق الإنتاج الرئيسية المستخدمة في الصين اليوم هي الاختزال الكهروكيميائي والهدرجة. على الصعيد العالمي ، يتم إنتاج معظم حمض السكسينيك عن طريق التخمير ، "الذي يمكن أن يقلل بشكل كبير من تكلفة التصنيع" ، كما جاء في التقرير. تقول ليرا إن الكثير من حمض الأسيتيك المنتج اليوم مصنوع من مادة الميثانول الأولية - الميثان إلى الميثانول إلى حمض الأسيتيك. يقول ليرا: "يمكن صنع حمض الخليك عن طريق التخمير أيضًا ، لكنني لست متأكدًا من مدى تنافسيته مع عملية البترول". "نحن نعمل الآن على أحماض السكسينيك ولكن لا يمكنني مشاركة التفاصيل حول ذلك حتى الآن لأن العمل مستمر." يستلزم العمل إسترة حمض السكسينيك بالإيثانول لصنع ثنائي إيثيل سكسينات.

بالنظر إلى أن العديد من هذه الأحماض يتم إنتاجها من خلال طرق أخرى غير التخمير ، فإن هذا سيوفر فرصة كبيرة لمصافي التكرير الحيوية المبنية على منصة الكيمياء الحيوية لتنويع تدفقات منتجاتها. لكن تطوير أسواق جديدة للأحماض العضوية ومركبات الإستر سيكون عنصرًا حاسمًا في هذا النهج. تقول ليرا: "إن الدرس الكبير الذي نتعلمه هو تحديد الأسواق". "سيكون هذا هو التحدي الكبير في اقتحام الأسواق ، وإيجاد الشركات لتكون أول من يستفيد من هذه الفرص."


الحيوان الجزيئي الخضري

[The Leaven - استكشاف العلاقة بين العلم والدين (تابع)]

الخميرة هي كائن حي مستأنس أصبح لا غنى عنه تقريبًا في المجتمع الحديث. على الرغم من أن أرفف السوبر ماركت غير ضرورية للنظام الغذائي الأساسي ، إلا أنها مكتظة بالمنتجات التي تتطلب تخمير الخميرة. يشمل إنتاج الخبز والشوكولاتة والكحول النشاط الأيضي لهذه الميكروبات أحادية الخلية البسيطة. تدور المطاعم والحانات والنوادي والعديد من جوانب السلوك الاجتماعي حول منتجات الخميرة.

على مر القرون ، كانت الخميرة محور الحياة المنزلية والصناعية. بينما كانت قدرتها على التخمير هي محور العديد من الفرضيات والتحولات النموذجية المختلفة. كان يُعتقد أن التخمير هو نتيجة تفاعل كيميائي بواسطة نوع من المادة وليس النشاط الأيضي للكائن الحي. خلال العصر التوراتي ، لم يكن هناك تصور بأن المسار الأيضي لحشرة مجهرية كان مصدر التخمير.

تتواجد الخمائر بشكل طبيعي في البيئة خاصة في التربة حيث يتم نقلها ، عن طريق الحشرات أو بوسائل أخرى ، إلى جلود الفاكهة والحيوانات ، بما في ذلك البشر. تحتوي البيئة على أنواع مختلفة من الخميرة ، من تلك التي تسبب العدوى الفطرية (الكانديدا spp.) للآخرين الذين يستخدمون في صناعة الخبز وإنتاج النبيذ (السكريات النيابة). الخميرة تنتمي إلى مملكة الفطريات والتقسيم أسكوميكوتا. في الآونة الأخيرة ، أصبحت لاعباً رئيسياً في الأبحاث البيولوجية وهي الآن واحدة من أكثر الكائنات الحية التي تمت دراستها على وجه الأرض. كان أول كائن حقيقي النواة يمتلك جينومًا متسلسلًا بالكامل. تم بحث غالبية جيناتها وتحليلها وظيفيًا ، وبما أن العديد منها لها نظائر في كائنات أخرى متعددة الخلايا ، فمن الممكن بالتالي دراسة العمليات الجزيئية من أنظمة الثدييات داخل نموذج وحيد الخلية حقيقيات النوى. كما أنه راسخ كبديل مناسب لأنظمة النماذج الحيوانية.

أنتجت التجارب واسعة النطاق التي تشمل أجهزة الكمبيوتر والروبوتات والتقنيات الجزيئية الجديدة ، مثل تفاعل البوليميراز المتسلسل (PCR) لتضخيم الجينات ومصفوفات الحمض النووي الدقيقة ، التي تنظم مئات من هذه الجينات على شبكة صغيرة ، كمية كبيرة من البيانات التي تطورت التخصصات العلمية الجديدة ، على سبيل المثال ، الجينوميات ، وعلم النسخ ، من أجل معالجتها كلها إلى نتائج ذات مغزى. إن بساطة دورة حياة الخميرة جعلتها لا تقدر بثمن في الأبحاث الطبية والتقنية الحيوية. بالتأكيد ، كان للخميرة تأثير كبير على مجتمع القرن الحادي والعشرين الذي تسبب في السلوك الاجتماعي والبحوث الطبية. كان من الممكن أن تتطور الأنثروبولوجيا بشكل مختلف إذا لم يعد هذا الكائن الحي موجودًا.


شاهد الفيديو: تخمر حمض اللاكتيك (كانون الثاني 2022).